header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-160119-4
Morpholino Name: MO4-lnx2b
Target: lnx2b (1)
Sequence:
5' - TGCAGCATGCACTAACCTGTTGTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-lnx2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-lnx2b
Expressed Gene Anatomy Figures
gcga Fig. 3 with image from Won et al., 2015
prss1 Fig. 3 with image from Won et al., 2015
PHENOTYPE
Phenotype resulting from MO4-lnx2b
No data available

Phenotype of all Fish created by or utilizing MO4-lnx2b
Genome Resources:
CITATIONS (1)