ZFIN ID: ZDB-MRPHLNO-151125-2
Morpholino Name: MO5-optn
Target: optn (1)
Sequence:
5' - AGAGCCTCTGTGGGATGCATATAAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-optn No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-optn No data available
PHENOTYPE
Phenotype resulting from MO5-optn
No data available

Phenotype of all Fish created by or utilizing MO5-optn
Phenotype Fish Conditions Figures
whole organism decreased life span, abnormal WT + MO5-optn bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. S11 with image from Chew et al., 2015
OTHER MO5-optn MORPHOLINO PAGESNo links to external sites
CITATIONS (1)