ZFIN ID: ZDB-MRPHLNO-151110-1
Morpholino Name: MO3-lrp5
Target: lrp5 (1)
Previous Name: lrp5MoUp (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGCTGCTCTTACAGTTTGTAGAGAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-lrp5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-lrp5 No data available
PHENOTYPE
Phenotype resulting from MO3-lrp5
No data available

Phenotype of all Fish created by or utilizing MO3-lrp5
Phenotype Fish Conditions Figures
hindbrain ccnd1 expression increased distribution, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 6 with image from Willems et al., 2015
cranial neural crest cell crestin expression decreased distribution, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
cell proliferation in hindbrain decreased occurrence, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 6 with image from Willems et al., 2015
cranial neural crest cell mislocalised, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
ceratobranchial 2 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 2 with image from Willems et al., 2015
cranial neural crest cell canonical Wnt signaling pathway decreased process quality, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 3 with image from Willems et al., 2015
cranium malformed, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 2 with image from Willems et al., 2015
cranial neural crest cell lef1 expression decreased distribution, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 3 with image from Willems et al., 2015
cranium lacks parts or has fewer parts of type ceratobranchial cartilage, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 2 with image from Willems et al., 2015
ceratobranchial 4 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 2 with image from Willems et al., 2015
rhombomere 6 dlx2a expression mislocalised, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
ceratobranchial 1 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 2 with image from Willems et al., 2015
cranial neural crest cell dlx2a expression decreased distribution, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
embryonic cranial skeleton morphogenesis process quality, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 2 with image from Willems et al., 2015
ceratobranchial 3 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 2 with image from Willems et al., 2015
rhombomere 6 crestin expression mislocalised, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
cranial neural crest cell neural crest cell migration decreased process quality, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
fourth ventricle swollen, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 2 with image from Willems et al., 2015
ceratobranchial 2 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 + MO4-tp53 standard conditions Fig. 2 with image from Willems et al., 2015
cranium malformed, abnormal WT + MO3-lrp5 + MO4-lrp5 + MO4-tp53 standard conditions Fig. 2 with image from Willems et al., 2015
ceratobranchial 4 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 + MO4-tp53 standard conditions Fig. 2 with image from Willems et al., 2015
ceratobranchial 1 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 + MO4-tp53 standard conditions Fig. 2 with image from Willems et al., 2015
ceratobranchial 3 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 + MO4-tp53 standard conditions Fig. 2 with image from Willems et al., 2015
embryonic cranial skeleton morphogenesis process quality, abnormal WT + MO3-lrp5 + MO4-lrp5 + MO4-tp53 standard conditions Fig. 2 with image from Willems et al., 2015
cranial neural crest cell decreased amount, abnormal ba2Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
cranial neural crest cell mislocalised, abnormal ba2Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
cranial neural crest cell neural crest cell migration decreased process quality, abnormal ba2Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
cranial neural crest cell EGFP expression decreased distribution, abnormal ba2Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
rhombomere 6 EGFP expression mislocalised, abnormal ba2Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
hindbrain canonical Wnt signaling pathway decreased process quality, abnormal w25Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 3 with image from Willems et al., 2015
tail bud GFP expression decreased distribution, abnormal w25Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 3 with image from Willems et al., 2015
midbrain hindbrain boundary GFP expression decreased distribution, abnormal w25Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 3 with image from Willems et al., 2015
hindbrain GFP expression decreased distribution, abnormal w25Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 3 with image from Willems et al., 2015
ceratobranchial 1 cartilage hypoplastic, abnormal y1Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 7 with image from Willems et al., 2015
ceratobranchial 2 cartilage aplastic, abnormal y1Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 7 with image from Willems et al., 2015
cranium malformed, abnormal y1Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 7 with image from Willems et al., 2015
ceratobranchial 4 cartilage aplastic, abnormal y1Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 7 with image from Willems et al., 2015
embryonic viscerocranium morphogenesis process quality, abnormal y1Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 7 with image from Willems et al., 2015
ceratobranchial 3 cartilage aplastic, abnormal y1Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 7 with image from Willems et al., 2015
Genome Resources:
CITATIONS (1)