ZFIN ID: ZDB-MRPHLNO-151005-2
Morpholino Name: MO6-vsx2
Target: vsx2 (1)
Previous Name: E2I2MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTTTCTTTAAGCCCACCTGTGTCGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO6-vsx2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO6-vsx2 No data available
PHENOTYPE
Phenotype resulting from MO6-vsx2
No data available

Phenotype of all Fish created by or utilizing MO6-vsx2
No data available
OTHER MO6-vsx2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)