ZFIN ID: ZDB-MRPHLNO-151002-4
Morpholino Name: MO2-elp1
Target: elp1 (1)
Previous Name: MO2-ikbkap

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGTTTATGTTTTCCTCAAGATGAGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-elp1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-elp1 No data available
PHENOTYPE
Phenotype resulting from MO2-elp1
Phenotype Figures
enteric nervous system development disrupted, abnormal text only from Cheng et al., 2015
intestine enteric neuron decreased amount, abnormal text only from Cheng et al., 2015
posterior intestine enteric neuron absent, abnormal text only from Cheng et al., 2015

Phenotype of all Fish created by or utilizing MO2-elp1
Phenotype Fish Conditions Figures
intestine enteric neuron decreased amount, abnormal WT + MO2-elp1 standard conditions text only from Cheng et al., 2015
enteric nervous system development disrupted, abnormal WT + MO2-elp1 standard conditions text only from Cheng et al., 2015
posterior intestine enteric neuron absent, abnormal WT + MO2-elp1 standard conditions text only from Cheng et al., 2015
OTHER MO2-elp1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)