ZFIN ID: ZDB-MRPHLNO-151002-3
Morpholino Name: MO1-elp1
Target: elp1 (1)
Previous Name: MO1-ikbkap

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCAGCAGACTGAGGTTTCTCATTGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-elp1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-elp1
Expressed Gene Anatomy Figures
phox2bb Fig. 3 from Cheng et al., 2015
ret Fig. 3 from Cheng et al., 2015
sox10 Fig. 3 from Cheng et al., 2015
PHENOTYPE
Phenotype resulting from MO1-elp1
Phenotype Figures
enteric nervous system development disrupted, abnormal Fig. 2 from Cheng et al., 2015
intestine enteric neuron decreased amount, abnormal Fig. 2 from Cheng et al., 2015
posterior intestine enteric neuron absent, abnormal Fig. 2 from Cheng et al., 2015

Phenotype of all Fish created by or utilizing MO1-elp1
Phenotype Fish Conditions Figures
intestine enteric neuron decreased amount, abnormal WT + MO1-elp1 standard conditions Fig. 2 from Cheng et al., 2015
enteric nervous system development disrupted, abnormal WT + MO1-elp1 standard conditions Fig. 2 from Cheng et al., 2015
posterior intestine enteric neuron absent, abnormal WT + MO1-elp1 standard conditions Fig. 2 from Cheng et al., 2015
OTHER MO1-elp1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)