Morpholino

MO1-inf2

ID

ZDB-MRPHLNO-150928-1

Name

MO1-inf2

Previous Names

ATG MO (1)

Target

inf2 (1)

Sequence

5' - GGGCTCCCTCTGCCTTCATCGACAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-inf2

Expressed Gene	Anatomy	Figures
nphs1	pronephric glomerulus	Fig. 4 from Sun et al., 2014

Phenotype

Phenotype resulting from MO1-inf2

Phenotype	Fish	Figures
glomerular basement membrane increased permeability, abnormal	WT + MO1-inf2	Fig. 5 from Sun et al., 2014
glomerular basement membrane microvillus crowded, abnormal	WT + MO1-inf2	Fig. 4 from Sun et al., 2014
glomerular basement membrane podocyte foot irregularly shaped, abnormal	WT + MO1-inf2	Fig. 4 from Sun et al., 2014
glomerular basement membrane podocyte foot protruding, abnormal	WT + MO1-inf2	Fig. 4 from Sun et al., 2014
glomerular basement membrane slit diaphragm absent, abnormal	WT + MO1-inf2	Fig. 4 from Sun et al., 2014
glomerular filtration disrupted, abnormal	WT + MO1-inf2	Fig. 5 from Sun et al., 2014
pericardium edematous, abnormal	WT + MO1-inf2	Fig. 3 from Sun et al., 2014
post-vent region sarcomere disorganized, abnormal	WT + MO1-inf2	Fig. 3 from Sun et al., 2014
pronephric glomerulus hypoplastic, abnormal	WT + MO1-inf2	Fig. 3 from Sun et al., 2014
pronephric tubule distended, abnormal	WT + MO1-inf2	Fig. 3 from Sun et al., 2014
pronephros immature, abnormal	WT + MO1-inf2	Fig. 3 from Sun et al., 2014
pronephros morphology, abnormal	WT + MO1-inf2	Fig. 7 from Sun et al., 2014
renal glomerulus immature, abnormal	WT + MO1-inf2	Fig. 3 from Sun et al., 2014
renal glomerulus slit diaphragm decreased functionality, abnormal	WT + MO1-inf2	Fig. 5 from Sun et al., 2014
whole organism viability, abnormal	WT + MO1-inf2	Fig. 7 from Sun et al., 2014
whole organism wholly dorsalized, abnormal	WT + MO1-inf2	Fig. 3 from Sun et al., 2014

Phenotype of all Fish created by or utilizing MO1-inf2

Phenotype	Fish	Conditions	Figures
renal glomerulus immature, abnormal	WT + MO1-inf2	standard conditions	Fig. 3 from Sun et al., 2014
glomerular basement membrane podocyte foot irregularly shaped, abnormal	WT + MO1-inf2	standard conditions	Fig. 4 from Sun et al., 2014
whole organism wholly dorsalized, abnormal	WT + MO1-inf2	standard conditions	Fig. 3 from Sun et al., 2014
pronephric tubule distended, abnormal	WT + MO1-inf2	standard conditions	Fig. 3 from Sun et al., 2014
pericardium edematous, abnormal	WT + MO1-inf2	standard conditions	Fig. 3 from Sun et al., 2014
glomerular basement membrane podocyte foot protruding, abnormal	WT + MO1-inf2	standard conditions	Fig. 4 from Sun et al., 2014
glomerular basement membrane microvillus crowded, abnormal	WT + MO1-inf2	standard conditions	Fig. 4 from Sun et al., 2014
pronephros immature, abnormal	WT + MO1-inf2	standard conditions	Fig. 3 from Sun et al., 2014
pronephros morphology, abnormal	WT + MO1-inf2	standard conditions	Fig. 7 from Sun et al., 2014
glomerular basement membrane slit diaphragm absent, abnormal	WT + MO1-inf2	standard conditions	Fig. 4 from Sun et al., 2014
renal glomerulus slit diaphragm decreased functionality, abnormal	WT + MO1-inf2	standard conditions	Fig. 5 from Sun et al., 2014
post-vent region sarcomere disorganized, abnormal	WT + MO1-inf2	standard conditions	Fig. 3 from Sun et al., 2014
whole organism viability, abnormal	WT + MO1-inf2	standard conditions	Fig. 7 from Sun et al., 2014
glomerular basement membrane increased permeability, abnormal	WT + MO1-inf2	standard conditions	Fig. 5 from Sun et al., 2014
pronephric glomerulus hypoplastic, abnormal	WT + MO1-inf2	standard conditions	Fig. 3 from Sun et al., 2014
glomerular filtration disrupted, abnormal	WT + MO1-inf2	standard conditions	Fig. 5 from Sun et al., 2014

Citations