ZFIN ID: ZDB-MRPHLNO-150831-6
Morpholino Name: MO5-th2
Target: th2 (1)
Sequence:
5' - TTATGCATTGTACGTACGGTTCAGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-th2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-th2 No data available
PHENOTYPE
Phenotype resulting from MO5-th2
No data available

Phenotype of all Fish created by or utilizing MO5-th2
Phenotype Fish Conditions Figures
caudal hypothalamic zone neuron hcrt expression increased amount, abnormal WT + MO4-th2 + MO5-th2 standard conditions Fig. 5 from Chen et al., 2016
head histamine increased amount, abnormal WT + MO4-th2 + MO5-th2 standard conditions Fig. 4 from Chen et al., 2016
caudal hypothalamic zone neuron hcrt expression increased distribution, abnormal WT + MO4-th2 + MO5-th2 standard conditions Fig. 5 from Chen et al., 2016
head th2 expression decreased amount, abnormal WT + MO4-th2 + MO5-th2 standard conditions Fig. 2 from Chen et al., 2016
head dopamine decreased amount, abnormal WT + MO4-th2 + MO5-th2 standard conditions Fig. 2 from Chen et al., 2016
caudal hypothalamic zone neuron hdc expression increased distribution, abnormal WT + MO4-th2 + MO5-th2 standard conditions Fig. 4 from Chen et al., 2016
caudal hypothalamic zone neuron ab1-histamine labeling increased amount, abnormal WT + MO4-th2 + MO5-th2 standard conditions Fig. 4 from Chen et al., 2016
head th expression decreased amount, abnormal WT + MO4-th + MO4-th2 + MO5-th + MO5-th2 standard conditions Fig. 2 from Chen et al., 2016
head th2 expression decreased amount, abnormal WT + MO4-th + MO4-th2 + MO5-th + MO5-th2 standard conditions Fig. 2 from Chen et al., 2016
OTHER MO5-th2 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)