ZFIN ID: ZDB-MRPHLNO-150205-2
Morpholino Name: MO1-ntrk1
Target: ntrk1 (1)
Sequence:
5' - TCGAATGAATCCAGCGGAATCTGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ntrk1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ntrk1 No data available
PHENOTYPE
Phenotype resulting from MO1-ntrk1
No data available

Phenotype of all Fish created by or utilizing MO1-ntrk1
Phenotype Fish Conditions Figures
whole organism decreased life span, abnormal WT + MO1-ntrk1 bacterial treatment Fig. 4 from Hepburn et al., 2014
neutrophil migration decreased process quality, abnormal i114Tg + MO1-ntrk1 amputation: caudal fin Fig. 4 from Hepburn et al., 2014
neutrophil migration decreased process quality, abnormal i114Tg + MO1-ntrk1 bacterial treatment Fig. 4 from Hepburn et al., 2014
OTHER MO1-ntrk1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)