ZFIN ID: ZDB-MRPHLNO-150129-1
Morpholino Name: MO2-notch2
Target: notch2 (1)
Sequence:
5' - TTCGAATGTGAAAGTCTTACCTGCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-notch2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-notch2
Expressed Gene Anatomy Figures
dlc Fig. S4 from Kim et al., 2014
efnb2a Fig. S4 from Kim et al., 2014
foxc1b Fig. S4 from Kim et al., 2014
kdrl Fig. S4 from Kim et al., 2014
myod1 Fig. S4 from Kim et al., 2014
runx1 Fig. S4 from Kim et al., 2014
twist1b Fig. S4 from Kim et al., 2014
PHENOTYPE
Phenotype resulting from MO2-notch2
Phenotype Figures
vasculature development process quality, abnormal Fig. S4 from Kim et al., 2014

Phenotype of all Fish created by or utilizing MO2-notch2
Phenotype Fish Conditions Figures
vasculature development process quality, abnormal AB + MO2-notch2 standard conditions Fig. S4 from Kim et al., 2014
OTHER MO2-notch2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)