Morpholino

MO1-kat8

ID
ZDB-MRPHLNO-141120-3
Name
MO1-kat8
Previous Names
None
Target
Sequence
5' - TGCAGTGTGAAAACTAAAGTTACCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-kat8
Expressed Gene Anatomy Figures
hbbe3 Fig. 2 from Huang et al., 2013
Phenotype
Phenotype resulting from MO1-kat8
Phenotype of all Fish created by or utilizing MO1-kat8
Citations