ZFIN ID: ZDB-MRPHLNO-141120-3
Morpholino Name: MO1-kat8
Target: kat8 (1)
Sequence:
5' - TGCAGTGTGAAAACTAAAGTTACCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-kat8 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-kat8
Expressed Gene Anatomy Figures
hbbe3 Fig. 2 from Huang et al., 2013
PHENOTYPE
Phenotype resulting from MO1-kat8
Phenotype of all Fish created by or utilizing MO1-kat8
Genome Resources:
CITATIONS (1)