ZFIN ID: ZDB-MRPHLNO-141120-21
Morpholino Name: MO1-phf2
Target: phf2 (1)
Sequence:
5' - AATACACGGGTACAGTCGCCATGTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-phf2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-phf2 No data available
PHENOTYPE
Phenotype resulting from MO1-phf2
No data available

Phenotype of all Fish created by or utilizing MO1-phf2
No data available
OTHER MO1-phf2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)