ZFIN ID: ZDB-MRPHLNO-141113-1
Morpholino Name: MO3-cacna1c
Target: cacna1c (1)
Previous Name: cav1.2 MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACATGTTTTTGCTTTCATTTACCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-cacna1c No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-cacna1c No data available
PHENOTYPE
Phenotype resulting from MO3-cacna1c
Phenotype Figures
brain hydrocephalic, abnormal Fig. 7 from Muntean et al., 2014
determination of heart left/right asymmetry disrupted, abnormal Fig. 7 from Muntean et al., 2014
heart looping disrupted, abnormal Fig. 7 from Muntean et al., 2014
pronephric duct cystic, abnormal Fig. 6 from Jin et al., 2014
pronephric duct dilated, abnormal Fig. 6 from Jin et al., 2014

Phenotype of all Fish created by or utilizing MO3-cacna1c
Phenotype Fish Conditions Figures
pronephric duct cystic, abnormal AB + MO3-cacna1c standard conditions Fig. 6 from Jin et al., 2014
brain hydrocephalic, abnormal AB + MO3-cacna1c standard conditions Fig. 7 from Muntean et al., 2014
determination of heart left/right asymmetry disrupted, abnormal AB + MO3-cacna1c standard conditions Fig. 7 from Muntean et al., 2014
heart looping disrupted, abnormal AB + MO3-cacna1c standard conditions Fig. 7 from Muntean et al., 2014
pronephric duct dilated, abnormal AB + MO3-cacna1c standard conditions Fig. 6 from Jin et al., 2014
OTHER MO3-cacna1c MORPHOLINO PAGESNo links to external sites
CITATIONS (2)