Morpholino
MO1-cxcr1
- ID
- ZDB-MRPHLNO-140915-2
- Name
- MO1-cxcr1
- Previous Names
- None
- Target
- Sequence
-
5' - TGTCAGGATACTAAACTTACCAGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
splice blocking: targeting the exon 1-intron 1 boundary
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cxcr1
No data available
Phenotype
Phenotype resulting from MO1-cxcr1
| Phenotype | Fish | Figures |
|---|---|---|
| blood island has fewer parts of type neutrophil, abnormal | WT + MO1-cxcr1 |
Fig. 6
from Deng et al., 2013 |
Phenotype of all Fish created by or utilizing MO1-cxcr1
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| blood island has fewer parts of type neutrophil, abnormal | WT + MO1-cxcr1 | standard conditions |
Fig. 6
from Deng et al., 2013 |
Citations