ZFIN ID: ZDB-MRPHLNO-140605-4
Morpholino Name: MO1-uba1
Target: uba1 (1)
Sequence:
5' - ACAGCGGCGAGCTGGACATCGTTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-uba1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-uba1 No data available
PHENOTYPE
Phenotype resulting from MO1-uba1
Phenotype Figures
motor neuron axon branchiness, abnormal Fig. 3 from Wishart et al., 2014
motor neuron collateral sprouting process quality, abnormal Fig. 3 from Wishart et al., 2014

Phenotype of all Fish created by or utilizing MO1-uba1
Phenotype Fish Conditions Figures
motor neuron collateral sprouting process quality, abnormal ml2Tg + MO1-uba1(EKW, TL) standard conditions Fig. 3 from Wishart et al., 2014
motor neuron axon branchiness, abnormal ml2Tg + MO1-uba1(EKW, TL) standard conditions Fig. 3 from Wishart et al., 2014
OTHER MO1-uba1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)