Morpholino

MO2-casp9

ID

ZDB-MRPHLNO-140331-2

Name

MO2-casp9

Previous Names

casp-9MO1 (1)

Target

casp9 (1)

Sequence

5' - GAATCTGTCTGTGTTTCTGCTCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-casp9

No data available

Phenotype

Phenotype resulting from MO2-casp9

Phenotype	Fish	Figures
retinal ganglion cell axon physical object quality, abnormal	WT + MO2-casp9	Fig. 1 from Campbell et al., 2013
retinal ganglion cell axon collateral physical object quality, abnormal	WT + MO2-casp9	Fig. 1 from Campbell et al., 2013
retinal ganglion cell cysteine-type endopeptidase activity decreased occurrence, abnormal	WT + MO2-casp9	Fig. 1 from Campbell et al., 2013

Phenotype of all Fish created by or utilizing MO2-casp9

Phenotype	Fish	Conditions	Figures
retinal ganglion cell axon physical object quality, abnormal	WT + MO2-casp9	standard conditions	Fig. 1 from Campbell et al., 2013
retinal ganglion cell axon collateral physical object quality, abnormal	WT + MO2-casp9	standard conditions	Fig. 1 from Campbell et al., 2013
retinal ganglion cell cysteine-type endopeptidase activity decreased occurrence, abnormal	WT + MO2-casp9	standard conditions	Fig. 1 from Campbell et al., 2013
retinal ganglion cell axon increased branchiness, abnormal	WT + MO1-slit1a + MO2-casp9	standard conditions	Fig. 6 from Campbell et al., 2013
retinal ganglion cell collateral sprouting in absence of injury increased occurrence, abnormal	WT + MO1-slit1a + MO2-casp9	standard conditions	Fig. 6 from Campbell et al., 2013
retinal ganglion cell axon collateral increased length, abnormal	WT + MO1-slit1a + MO2-casp9	standard conditions	Fig. 6 from Campbell et al., 2013
retinal ganglion cell axon has extra parts of type retinal ganglion cell presynaptic active zone, abnormal	WT + MO1-slit1a + MO2-casp9	standard conditions	Fig. 6 from Campbell et al., 2013
retinal ganglion cell axon collateral increased length, abnormal	WT + MO2-casp9 + MO3-robo2	standard conditions	Fig. 6 from Campbell et al., 2013
retinal ganglion cell axon has extra parts of type retinal ganglion cell presynaptic active zone, abnormal	WT + MO2-casp9 + MO3-robo2	standard conditions	Fig. 6 from Campbell et al., 2013
retinal ganglion cell axon increased branchiness, abnormal	WT + MO2-casp9 + MO3-robo2	standard conditions	Fig. 6 from Campbell et al., 2013
retinal ganglion cell collateral sprouting in absence of injury increased occurrence, abnormal	WT + MO2-casp9 + MO3-robo2	standard conditions	Fig. 6 from Campbell et al., 2013

Citations