header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-140310-2
Morpholino Name: MO2-six6b
Target: six6b (1)
Previous Name: SB-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTAAATCTGGAAAACGCACCTGTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-six6b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-six6b
Expressed Gene Anatomy Figures
cdkn1a Fig. 3 from Springelkamp et al., 2017
cdkn2a/b Fig. 3 from Springelkamp et al., 2017
PHENOTYPE
Phenotype resulting from MO2-six6b
Phenotype Figures
cranial nerve II decreased thickness, abnormal Fig. text only from Springelkamp et al., 2017
Fig. 2 from Iglesias et al., 2014
eye decreased size, abnormal Fig. text only from Springelkamp et al., 2017
Fig. 1Fig. 2 from Iglesias et al., 2014
eye hypoplastic, abnormal Fig. 2 from Iglesias et al., 2014
eye immature, abnormal Fig. 2 from Iglesias et al., 2014
eye cdkn1a expression increased amount, abnormal Fig. 3 from Springelkamp et al., 2017
eye cdkn2a/b expression increased amount, abnormal Fig. 3 from Springelkamp et al., 2017
eye development delayed, abnormal Fig. 1Fig. 2 from Iglesias et al., 2014
head decreased size, abnormal Fig. text only from Springelkamp et al., 2017
Fig. 1 from Iglesias et al., 2014
lens cellularity, abnormal Fig. 2Fig. 4 from Iglesias et al., 2014
lens immature, abnormal Fig. 2 from Iglesias et al., 2014
mandibular arch skeleton decreased size, abnormal Fig. text only from Springelkamp et al., 2017
mandibular arch skeleton shortened, abnormal Fig. 1 from Iglesias et al., 2014
pericardium edematous, abnormal Fig. text only from Springelkamp et al., 2017
Fig. 1 from Iglesias et al., 2014
pigmentation process quality, abnormal Fig. 1 from Iglesias et al., 2014
retina proliferative, abnormal Fig. 4 from Iglesias et al., 2014
retina cell population proliferation process quality, abnormal Fig. 4 from Iglesias et al., 2014
retina layer formation delayed, abnormal Fig. 4 from Iglesias et al., 2014
whole organism decreased pigmentation, abnormal Fig. text only from Springelkamp et al., 2017

Phenotype of all Fish created by or utilizing MO2-six6b
Phenotype Fish Conditions Figures
eye decreased size, abnormal WT + MO2-six6b standard conditions Fig. text only from Springelkamp et al., 2017
Fig. 1Fig. 2 from Iglesias et al., 2014
cranial nerve II decreased thickness, abnormal WT + MO2-six6b standard conditions Fig. text only from Springelkamp et al., 2017
Fig. 2 from Iglesias et al., 2014
eye cdkn1a expression increased amount, abnormal WT + MO2-six6b standard conditions Fig. 3 from Springelkamp et al., 2017
retina proliferative, abnormal WT + MO2-six6b standard conditions Fig. 4 from Iglesias et al., 2014
retina layer formation delayed, abnormal WT + MO2-six6b standard conditions Fig. 4 from Iglesias et al., 2014
eye immature, abnormal WT + MO2-six6b standard conditions Fig. 2 from Iglesias et al., 2014
eye cdkn2a/b expression increased amount, abnormal WT + MO2-six6b standard conditions Fig. 3 from Springelkamp et al., 2017
whole organism decreased pigmentation, abnormal WT + MO2-six6b standard conditions Fig. text only from Springelkamp et al., 2017
eye hypoplastic, abnormal WT + MO2-six6b standard conditions Fig. 2 from Iglesias et al., 2014
lens immature, abnormal WT + MO2-six6b standard conditions Fig. 2 from Iglesias et al., 2014
pigmentation process quality, abnormal WT + MO2-six6b standard conditions Fig. 1 from Iglesias et al., 2014
retina cell population proliferation process quality, abnormal WT + MO2-six6b standard conditions Fig. 4 from Iglesias et al., 2014
eye development delayed, abnormal WT + MO2-six6b standard conditions Fig. 1Fig. 2 from Iglesias et al., 2014
head decreased size, abnormal WT + MO2-six6b standard conditions Fig. text only from Springelkamp et al., 2017
Fig. 1 from Iglesias et al., 2014
mandibular arch skeleton shortened, abnormal WT + MO2-six6b standard conditions Fig. 1 from Iglesias et al., 2014
pericardium edematous, abnormal WT + MO2-six6b standard conditions Fig. text only from Springelkamp et al., 2017
Fig. 1 from Iglesias et al., 2014
lens cellularity, abnormal WT + MO2-six6b standard conditions Fig. 2Fig. 4 from Iglesias et al., 2014
mandibular arch skeleton decreased size, abnormal WT + MO2-six6b standard conditions Fig. text only from Springelkamp et al., 2017
eye decreased size, abnormal WT + MO2-six6b + MO4-tp53 standard conditions Fig. 1 from Iglesias et al., 2014
pericardium edematous, abnormal WT + MO2-six6b + MO4-tp53 standard conditions Fig. 1 from Iglesias et al., 2014
eye development delayed, abnormal WT + MO2-six6b + MO4-tp53 standard conditions Fig. 1 from Iglesias et al., 2014
head decreased size, abnormal WT + MO2-six6b + MO4-tp53 standard conditions Fig. 1 from Iglesias et al., 2014
pigmentation process quality, abnormal WT + MO2-six6b + MO4-tp53 standard conditions Fig. 1 from Iglesias et al., 2014
mandibular arch skeleton shortened, abnormal WT + MO2-six6b + MO4-tp53 standard conditions Fig. 1 from Iglesias et al., 2014
Genome Resources:
CITATIONS (2)