ZFIN ID: ZDB-MRPHLNO-140310-10
Morpholino Name: MO3-arap3
Target: arap3 (1)
Previous Name: arap3a spl MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTTAGCAAAAAGGCTGTACCTATGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-arap3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-arap3
Expressed Gene Anatomy Figures
sox18 Fig. 2 from Kartopawiro et al., 2014
PHENOTYPE
Phenotype resulting from MO3-arap3
Phenotype of all Fish created by or utilizing MO3-arap3
Genome Resources:
CITATIONS (1)