ZFIN ID: ZDB-MRPHLNO-140205-7
Morpholino Name: MO3-apoc1
Target: apoc1 (1)
Previous Names: c1bMO1 (1), MO3-apoc1l

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCAGGTCCTCTGCAATCTCCTTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-apoc1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-apoc1 No data available
PHENOTYPE
Phenotype resulting from MO3-apoc1
Phenotype Figures
cell migration involved in gastrulation process quality, abnormal Fig. 4Fig. 6 from Wang et al., 2013
DEL epiboly arrested, abnormal Fig. 4 from Wang et al., 2013
DEL epiboly temporally extended, abnormal Fig. 4 from Wang et al., 2013
epiboly process quality, abnormal Fig. 3 from Wang et al., 2013
EVL epiboly temporally extended, abnormal Fig. 4 from Wang et al., 2013
whole organism malformed, abnormal Fig. 3 from Wang et al., 2013
yolk syncytial layer epiboly temporally extended, abnormal Fig. 4 from Wang et al., 2013

Phenotype of all Fish created by or utilizing MO3-apoc1
Phenotype Fish Conditions Figures
EVL epiboly temporally extended, abnormal WT + MO3-apoc1 standard conditions Fig. 4 from Wang et al., 2013
yolk syncytial layer epiboly temporally extended, abnormal WT + MO3-apoc1 standard conditions Fig. 4 from Wang et al., 2013
DEL epiboly arrested, abnormal WT + MO3-apoc1 standard conditions Fig. 4 from Wang et al., 2013
whole organism malformed, abnormal WT + MO3-apoc1 standard conditions Fig. 3 from Wang et al., 2013
epiboly process quality, abnormal WT + MO3-apoc1 standard conditions Fig. 3 from Wang et al., 2013
cell migration involved in gastrulation process quality, abnormal WT + MO3-apoc1 standard conditions Fig. 4Fig. 6 from Wang et al., 2013
DEL epiboly temporally extended, abnormal WT + MO3-apoc1 standard conditions Fig. 4 from Wang et al., 2013
OTHER MO3-apoc1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)