ZFIN ID: ZDB-MRPHLNO-140205-7
Morpholino Name: MO3-apoc1
Target: apoc1 (1)
Previous Names: c1bMO1 (1), MO3-apoc1l

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCAGGTCCTCTGCAATCTCCTTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-apoc1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-apoc1 No data available
PHENOTYPE
Phenotype resulting from MO3-apoc1
Phenotype of all Fish created by or utilizing MO3-apoc1
Genome Resources:
CITATIONS (1)