ZFIN ID: ZDB-MRPHLNO-131202-2
Morpholino Name: MO1-hps5
Target: hps5 (1)
Sequence:
5' - TGAAGGATTAAGAGGAATACCTGGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-hps5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-hps5 No data available
PHENOTYPE
Phenotype resulting from MO1-hps5
Phenotype of all Fish created by or utilizing MO1-hps5
Genome Resources:
CITATIONS (1)