ZFIN ID: ZDB-MRPHLNO-131119-8
Morpholino Name: MO5-dkk1b
Target: dkk1b (1)
Sequence:
5' - GCATATTTCTATGCTTACCTGCGGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-dkk1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-dkk1b No data available
PHENOTYPE
Phenotype resulting from MO5-dkk1b
No data available

Phenotype of all Fish created by or utilizing MO5-dkk1b
No data available
OTHER MO5-dkk1b MORPHOLINO PAGESNo links to external sites
CITATIONS (2)