Morpholino

MO1-tfpi2

ID
ZDB-MRPHLNO-131016-1
Name
MO1-tfpi2
Previous Names
  • exon/intron 2 (1)
Target
Sequence
5' - GAAAATGAACGTACTTGGTATCCTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tfpi2
Phenotype
Phenotype resulting from MO1-tfpi2
Phenotype Fish Figures
atrioventricular canal malformed, abnormal WT + MO1-tfpi2 Fig. 2 from Zhang et al., 2015
atrium dilated, abnormal WT + MO1-tfpi2 Fig. 2 from Zhang et al., 2015
cardiac muscle cell cardiac myofibril decreased amount, abnormal WT + MO1-tfpi2 Fig. 3 from Zhang et al., 2015
cardiac muscle cell sarcomere disorganized, abnormal WT + MO1-tfpi2 Fig. 3 from Zhang et al., 2015
cardiac muscle cell sarcomere organization disrupted, abnormal WT + MO1-tfpi2 Fig. 3 from Zhang et al., 2015
cardiac muscle cell Z disc disorganized, abnormal WT + MO1-tfpi2 Fig. 3 from Zhang et al., 2015
cardiac ventricle decreased size, abnormal WT + MO1-tfpi2 Fig. 2 from Zhang et al., 2015
fourth ventricle decreased size, abnormal AB + MO1-tfpi2 + MO4-tp53 Fig. 4 with image from Zhang et al., 2013
glial cell (sensu Vertebrata) decreased amount, abnormal mi2001Tg + MO1-tfpi2 Fig. 8 with image from Zhang et al., 2013
head decreased size, abnormal WT + MO1-tfpi2 text only from Zhang et al., 2015
heart malformed, abnormal WT + MO1-tfpi2 Fig. 1 from Zhang et al., 2015
heart contraction decreased rate, abnormal WT + MO1-tfpi2 text only from Zhang et al., 2015
heart development disrupted, abnormal WT + MO1-tfpi2 Fig. 1Fig. 2 from Zhang et al., 2015
hemoglobin biosynthetic process disrupted, abnormal WT + MO1-tfpi2 Fig. 4 from Zhang et al., 2015
hemopoiesis disrupted, abnormal WT + MO1-tfpi2 Fig. 1Fig. 4 from Zhang et al., 2015
locomotion decreased occurrence, abnormal WT + MO1-tfpi2 text only from Zhang et al., 2015
midbrain hindbrain boundary malformed, abnormal AB + MO1-tfpi2 Fig. 4 with imageFig. S4 with image from Zhang et al., 2013
midbrain hindbrain boundary nerve sparse, abnormal AB + MO1-tfpi2 Fig. S6 with image from Zhang et al., 2013
nucleate erythrocyte hemoglobin complex decreased amount, abnormal WT + MO1-tfpi2 Fig. 1Fig. 4 from Zhang et al., 2015
pericardium edematous, abnormal AB + MO1-tfpi2 Fig. 1text only from Zhang et al., 2015
text only from Zhang et al., 2013
retina photoreceptor cell disorganized, abnormal AB + MO1-tfpi2 Fig. S6 with image from Zhang et al., 2013
third ventricle decreased size, abnormal AB + MO1-tfpi2 + MO4-tp53 Fig. 4 with image from Zhang et al., 2013
whole organism decreased length, abnormal AB + MO1-tfpi2 text only from Zhang et al., 2013
whole organism decreased pigmentation, abnormal AB + MO1-tfpi2 Fig. S4 with image from Zhang et al., 2013
yolk increased size, abnormal WT + MO1-tfpi2 Fig. 1text only from Zhang et al., 2015
text only from Zhang et al., 2013
Phenotype of all Fish created by or utilizing MO1-tfpi2
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal AB + MO1-tfpi2 standard conditions text only from Zhang et al., 2013
third ventricle decreased size, abnormal AB + MO1-tfpi2 standard conditions Fig. 4 with image from Zhang et al., 2013
retina photoreceptor cell disorganized, abnormal AB + MO1-tfpi2 standard conditions Fig. S6 with image from Zhang et al., 2013
yolk increased size, abnormal AB + MO1-tfpi2 standard conditions text only from Zhang et al., 2013
fourth ventricle decreased size, abnormal AB + MO1-tfpi2 standard conditions Fig. 4 with image from Zhang et al., 2013
pericardium edematous, abnormal AB + MO1-tfpi2 standard conditions text only from Zhang et al., 2013
midbrain hindbrain boundary nerve sparse, abnormal AB + MO1-tfpi2 standard conditions Fig. S6 with image from Zhang et al., 2013
whole organism decreased pigmentation, abnormal AB + MO1-tfpi2 standard conditions Fig. S4 with image from Zhang et al., 2013
midbrain hindbrain boundary malformed, abnormal AB + MO1-tfpi2 standard conditions Fig. 4 with imageFig. S4 with image from Zhang et al., 2013
midbrain hindbrain boundary malformed, abnormal AB + MO1-tfpi2 + MO4-tp53 standard conditions Fig. 4 with image from Zhang et al., 2013
third ventricle decreased size, abnormal AB + MO1-tfpi2 + MO4-tp53 standard conditions Fig. 4 with image from Zhang et al., 2013
fourth ventricle decreased size, abnormal AB + MO1-tfpi2 + MO4-tp53 standard conditions Fig. 4 with image from Zhang et al., 2013
atrium dilated, abnormal WT + MO1-tfpi2 standard conditions Fig. 2 from Zhang et al., 2015
nucleate erythrocyte hemoglobin complex decreased amount, abnormal WT + MO1-tfpi2 standard conditions Fig. 1Fig. 4 from Zhang et al., 2015
locomotion decreased occurrence, abnormal WT + MO1-tfpi2 standard conditions text only from Zhang et al., 2015
heart contraction decreased rate, abnormal WT + MO1-tfpi2 standard conditions text only from Zhang et al., 2015
yolk increased size, abnormal WT + MO1-tfpi2 standard conditions Fig. 1text only from Zhang et al., 2015
cardiac muscle cell sarcomere disorganized, abnormal WT + MO1-tfpi2 standard conditions Fig. 3 from Zhang et al., 2015
hemopoiesis disrupted, abnormal WT + MO1-tfpi2 standard conditions Fig. 1Fig. 4 from Zhang et al., 2015
cardiac ventricle decreased size, abnormal WT + MO1-tfpi2 standard conditions Fig. 2 from Zhang et al., 2015
cardiac muscle cell cardiac myofibril decreased amount, abnormal WT + MO1-tfpi2 standard conditions Fig. 3 from Zhang et al., 2015
hemoglobin biosynthetic process disrupted, abnormal WT + MO1-tfpi2 standard conditions Fig. 4 from Zhang et al., 2015
cardiac muscle cell sarcomere organization disrupted, abnormal WT + MO1-tfpi2 standard conditions Fig. 3 from Zhang et al., 2015
cardiac muscle cell Z disc disorganized, abnormal WT + MO1-tfpi2 standard conditions Fig. 3 from Zhang et al., 2015
head decreased size, abnormal WT + MO1-tfpi2 standard conditions text only from Zhang et al., 2015
heart malformed, abnormal WT + MO1-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
atrioventricular canal malformed, abnormal WT + MO1-tfpi2 standard conditions Fig. 2 from Zhang et al., 2015
heart development disrupted, abnormal WT + MO1-tfpi2 standard conditions Fig. 1Fig. 2 from Zhang et al., 2015
pericardium edematous, abnormal WT + MO1-tfpi2 standard conditions Fig. 1text only from Zhang et al., 2015
nucleate erythrocyte hemoglobin complex decreased amount, abnormal WT + MO1-tfpi2 + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
heart malformed, abnormal WT + MO1-tfpi2 + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
hemopoiesis disrupted, abnormal WT + MO1-tfpi2 + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
heart development disrupted, abnormal WT + MO1-tfpi2 + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
yolk increased size, abnormal WT + MO1-tfpi2 + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
pericardium edematous, abnormal WT + MO1-tfpi2 + MO2-tfpi2 standard conditions Fig. 1 from Zhang et al., 2015
glial cell (sensu Vertebrata) decreased amount, abnormal mi2001Tg + MO1-tfpi2 standard conditions Fig. 8 with image from Zhang et al., 2013
Citations