Morpholino

MO1-bcor

ID

ZDB-MRPHLNO-130911-9

Name

MO1-bcor

Previous Names

bcor-MO (1)

Target

bcor (1)

Sequence

5' - AGCTCTCTTACCGGAAAGAAAACAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-bcor

Expressed Gene	Anatomy	Figures
tp53	retina	Fig. 6 from Lee et al., 2013

Phenotype

Phenotype resulting from MO1-bcor

Phenotype	Fish	Figures
forebrain retinal pigmented epithelium mislocalized adaxially, abnormal	WT + MO1-bcor	Fig. 6 from Lee et al., 2013
retina perforate, abnormal	WT + MO1-bcor	Fig. 6 from Lee et al., 2013
retina cell apoptotic, abnormal	WT + MO1-bcor	Fig. 6 from Lee et al., 2013
retina intrinsic apoptotic signaling pathway by p53 class mediator increased occurrence, abnormal	WT + MO1-bcor	Fig. 6 from Lee et al., 2013
retina ventral region mislocalized adaxially, abnormal	WT + MO1-bcor	Fig. 6 from Lee et al., 2013
retina morphogenesis in camera-type eye disrupted, abnormal	WT + MO1-bcor	Fig. 6 from Lee et al., 2013

Phenotype of all Fish created by or utilizing MO1-bcor

Phenotype	Fish	Conditions	Figures
retina perforate, abnormal	WT + MO1-bcor	standard conditions	Fig. 6 from Lee et al., 2013
retina morphogenesis in camera-type eye disrupted, abnormal	WT + MO1-bcor	chemical treatment: trichloroacetic acid	Fig. 9 from Lee et al., 2013
forebrain retinal pigmented epithelium mislocalized adaxially, abnormal	WT + MO1-bcor	standard conditions	Fig. 6 from Lee et al., 2013
optic fissure open, abnormal	WT + MO1-bcor	chemical treatment: trichloroacetic acid	Fig. 9 from Lee et al., 2013
retina morphogenesis in camera-type eye disrupted, abnormal	WT + MO1-bcor	standard conditions	Fig. 6 from Lee et al., 2013
retina ventral region mislocalized adaxially, abnormal	WT + MO1-bcor	standard conditions	Fig. 6 from Lee et al., 2013
retina perforate, abnormal	WT + MO1-bcor	chemical treatment: trichloroacetic acid	Fig. 9 from Lee et al., 2013
retina intrinsic apoptotic signaling pathway by p53 class mediator increased occurrence, abnormal	WT + MO1-bcor	standard conditions	Fig. 6 from Lee et al., 2013
retina cell apoptotic, abnormal	WT + MO1-bcor	standard conditions	Fig. 6 from Lee et al., 2013
retina perforate, abnormal	hdac1^hi1618Tg/+ + MO1-bcor (AB)	standard conditions	Fig. 9 from Lee et al., 2013
optic fissure open, abnormal	hdac1^hi1618Tg/+ + MO1-bcor (AB)	standard conditions	Fig. 9 from Lee et al., 2013
retina morphogenesis in camera-type eye disrupted, abnormal	hdac1^hi1618Tg/+ + MO1-bcor (AB)	standard conditions	Fig. 9 from Lee et al., 2013
optic fissure open, abnormal	WT + MO1-bcl6aa + MO1-bcor	standard conditions	Fig. 6 from Lee et al., 2013
retina morphogenesis in camera-type eye disrupted, abnormal	WT + MO1-bcl6aa + MO1-bcor	standard conditions	Fig. 6 from Lee et al., 2013
retina perforate, abnormal	WT + MO1-bcl6aa + MO1-bcor	standard conditions	Fig. 6 from Lee et al., 2013
heart edematous, abnormal	WT + MO1-bcor + MO1-rnf2	standard conditions	Fig. 7 from Lee et al., 2013
optic fissure open, abnormal	WT + MO1-bcor + MO1-rnf2	standard conditions	Fig. 7 from Lee et al., 2013
pectoral fin absent, abnormal	WT + MO1-bcor + MO1-rnf2	standard conditions	Fig. 7 from Lee et al., 2013
retina morphogenesis in camera-type eye disrupted, abnormal	WT + MO1-bcor + MO1-rnf2	standard conditions	Fig. 7 from Lee et al., 2013
retina perforate, abnormal	WT + MO1-bcor + MO1-rnf2	standard conditions	Fig. 7 from Lee et al., 2013

Citations