Morpholino

MO1-bcl6aa

ID
ZDB-MRPHLNO-130911-7
Name
MO1-bcl6aa
Previous Names
  • bcl6a-SPMO (1)
  • MO1-bcl6a
Target
Sequence
5' - GCAAGCAGCCTTCAATTGTACCTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bcl6aa
Expressed Gene Anatomy Figures
tp53 Fig. 4 from Lee et al., 2013
Phenotype
Phenotype resulting from MO1-bcl6aa
Phenotype Fish Figures
forebrain retinal pigmented epithelium mislocalized adaxially, abnormal WT + MO1-bcl6aa Fig. 2,  Fig. 4 from Lee et al., 2013
lens cell apoptotic, abnormal WT + MO1-bcl6aa Fig. 4 from Lee et al., 2013
optic fissure open, abnormal WT + MO1-bcl6aa Fig. 4 from Lee et al., 2013
retina perforate, abnormal WT + MO1-bcl6aa Fig. 2,  Fig. 3,  Fig. 4 from Lee et al., 2013
retina cell apoptotic, abnormal WT + MO1-bcl6aa Fig. 4 from Lee et al., 2013
retina intrinsic apoptotic signaling pathway by p53 class mediator increased occurrence, abnormal WT + MO1-bcl6aa Fig. 4 from Lee et al., 2013
retina morphogenesis in camera-type eye disrupted, abnormal WT + MO1-bcl6aa Fig. 2,  Fig. 3,  Fig. 4 from Lee et al., 2013
trunk curved lateral, abnormal WT + MO1-bcl6aa Fig. 2 from Lee et al., 2013
Phenotype of all Fish created by or utilizing MO1-bcl6aa
Phenotype Fish Conditions Figures
retina perforate, abnormal WT + MO1-bcl6aa standard conditions Fig. 2,  Fig. 3,  Fig. 4 from Lee et al., 2013
lens cell apoptotic, abnormal WT + MO1-bcl6aa standard conditions Fig. 4 from Lee et al., 2013
optic fissure open, abnormal WT + MO1-bcl6aa chemical treatment: trichloroacetic acid Fig. 8 from Lee et al., 2013
retina morphogenesis in camera-type eye disrupted, abnormal WT + MO1-bcl6aa standard conditions Fig. 2,  Fig. 3,  Fig. 4 from Lee et al., 2013
optic fissure open, abnormal WT + MO1-bcl6aa standard conditions Fig. 4 from Lee et al., 2013
retina morphogenesis in camera-type eye disrupted, abnormal WT + MO1-bcl6aa chemical treatment: trichloroacetic acid Fig. 8 from Lee et al., 2013
retina intrinsic apoptotic signaling pathway by p53 class mediator increased occurrence, abnormal WT + MO1-bcl6aa standard conditions Fig. 4 from Lee et al., 2013
trunk curved lateral, abnormal WT + MO1-bcl6aa standard conditions Fig. 2 from Lee et al., 2013
retina perforate, abnormal WT + MO1-bcl6aa chemical treatment: trichloroacetic acid Fig. 8 from Lee et al., 2013
retina cell apoptotic, abnormal WT + MO1-bcl6aa standard conditions Fig. 4 from Lee et al., 2013
forebrain retinal pigmented epithelium mislocalized adaxially, abnormal WT + MO1-bcl6aa standard conditions Fig. 2,  Fig. 4 from Lee et al., 2013
optic fissure open, abnormal WT + MO1-bcl6aa + MO1-bcor standard conditions Fig. 6 from Lee et al., 2013
retina morphogenesis in camera-type eye disrupted, abnormal WT + MO1-bcl6aa + MO1-bcor standard conditions Fig. 6 from Lee et al., 2013
retina perforate, abnormal WT + MO1-bcl6aa + MO1-bcor standard conditions Fig. 6 from Lee et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.