ZFIN ID: ZDB-MRPHLNO-130617-1
Morpholino Name: MO2-ddit3
Target: ddit3 (1)
Previous Name: CHOP-10 MO ATG (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CAGCCACTCCGCAGTCATCGCACC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-ddit3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-ddit3 No data available
PHENOTYPE
Phenotype resulting from MO2-ddit3
Phenotype Figures
lipid biosynthetic process process quality, abnormal Fig. 5 from Her et al., 2013

Phenotype of all Fish created by or utilizing MO2-ddit3
Phenotype Fish Conditions Figures
lipid biosynthetic process process quality, abnormal WT + MO2-ddit3 standard conditions Fig. 5 from Her et al., 2013
lipid biosynthetic process process quality, abnormal two16Tg + MO2-ddit3 standard conditions Fig. 5 from Her et al., 2013
OTHER MO2-ddit3 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)