ZFIN ID: ZDB-MRPHLNO-130520-1
Morpholino Name: MO1-optn
Target: optn (1)
Previous Name: OPTN ATG-AMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGATGATCCAGATGCCATGCTTTCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-optn No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-optn No data available
PHENOTYPE
Phenotype resulting from MO1-optn
Phenotype Figures
motor neuron axon decreased length, abnormal Fig. 7 with image from Korac et al., 2013
motor neuron axon increased branchiness, abnormal Fig. 7 with image from Korac et al., 2013
post-vent region curved, abnormal Fig. 7 with image from Korac et al., 2013
swimming behavior decreased process quality, abnormal text only from Korac et al., 2013

Phenotype of all Fish created by or utilizing MO1-optn
Phenotype Fish Conditions Figures
post-vent region curved, abnormal TU + MO1-optn standard conditions Fig. 7 with image from Korac et al., 2013
motor neuron axon increased branchiness, abnormal TU + MO1-optn standard conditions Fig. 7 with image from Korac et al., 2013
motor neuron axon decreased length, abnormal TU + MO1-optn standard conditions Fig. 7 with image from Korac et al., 2013
swimming behavior decreased process quality, abnormal TU + MO1-optn standard conditions text only from Korac et al., 2013
OTHER MO1-optn MORPHOLINO PAGESNo links to external sites
CITATIONS (1)