ZFIN ID: ZDB-MRPHLNO-130516-2
Morpholino Name: MO2-pcdh17
Target: pcdh17 (1)
Previous Name: pch17sMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ATATAAGTTGTCGCTCCTACCTGTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-pcdh17 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-pcdh17 No data available
PHENOTYPE
Phenotype resulting from MO2-pcdh17
Phenotype Figures
cell population proliferation disrupted, abnormal Fig. 3 from Chen et al., 2013
cranial nerve II decreased thickness, abnormal Fig. 5 from Chen et al., 2013
eye decreased size, abnormal Fig. 1Fig. 6 from Chen et al., 2013
retinal ganglion cell layer decreased size, abnormal Fig. 5 from Chen et al., 2013
retinal inner plexiform layer decreased size, abnormal Fig. 5 from Chen et al., 2013

Phenotype of all Fish created by or utilizing MO2-pcdh17
Phenotype Fish Conditions Figures
cranial nerve II decreased thickness, abnormal WT + MO2-pcdh17 standard conditions Fig. 5 from Chen et al., 2013
retinal inner plexiform layer decreased size, abnormal WT + MO2-pcdh17 standard conditions Fig. 5 from Chen et al., 2013
cell population proliferation disrupted, abnormal WT + MO2-pcdh17 standard conditions Fig. 3 from Chen et al., 2013
eye decreased size, abnormal WT + MO2-pcdh17 standard conditions Fig. 1Fig. 6 from Chen et al., 2013
retinal ganglion cell layer decreased size, abnormal WT + MO2-pcdh17 standard conditions Fig. 5 from Chen et al., 2013
OTHER MO2-pcdh17 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)