ZFIN ID: ZDB-MRPHLNO-130408-6
Morpholino Name: MO4-pak4
Target: pak4 (1)
Previous Name: Splice MO-2 (for cryptic donor site) (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTTCTCCCAGAGTCACTTTCAGAGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-pak4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-pak4 No data available
PHENOTYPE
Phenotype resulting from MO4-pak4
No data available

Phenotype of all Fish created by or utilizing MO4-pak4
Phenotype Fish Conditions Figures
myeloid leukocyte decreased amount, abnormal EKW + MO3-pak4 + MO4-pak4 + MO5-pak4 standard conditions Fig. S3 with image from Law et al., 2013
cranial cartilage morphology, abnormal EKW + MO3-pak4 + MO4-pak4 + MO5-pak4 standard conditions Fig. 2 with image from Law et al., 2013
embryonic morphogenesis disrupted, abnormal EKW + MO3-pak4 + MO4-pak4 + MO5-pak4 standard conditions Fig. 2 with image from Law et al., 2013
somite malformed, abnormal EKW + MO3-pak4 + MO4-pak4 + MO5-pak4 standard conditions Fig. 2 with image from Law et al., 2013
whole organism anterior-posterior axis shortened, abnormal EKW + MO3-pak4 + MO4-pak4 + MO5-pak4 standard conditions Fig. 2 with image from Law et al., 2013
head decreased size, abnormal EKW + MO3-pak4 + MO4-pak4 + MO5-pak4 standard conditions Fig. 2 with image from Law et al., 2013
eye decreased size, abnormal EKW + MO3-pak4 + MO4-pak4 + MO5-pak4 standard conditions Fig. 2 with image from Law et al., 2013
myeloid cell differentiation disrupted, abnormal EKW + MO3-pak4 + MO4-pak4 + MO5-pak4 standard conditions Fig. 3 with image from Law et al., 2013
OTHER MO4-pak4 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)