ZFIN ID: ZDB-MRPHLNO-130403-1
Morpholino Name: MO1-mnx2a
Target: mnx2a (1)
Sequence:
5' - TTCGACTTATCCATGAAGGCAAACT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mnx2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mnx2a
Expressed Gene Anatomy Figures
ins Fig. 6 with image from Wendik et al., 2004
mnx2a Fig. 6 with image from Wendik et al., 2004
prss1 Fig. 6 with image from Wendik et al., 2004
PHENOTYPE
Phenotype resulting from MO1-mnx2a
No data available

Phenotype of all Fish created by or utilizing MO1-mnx2a
Genome Resources:
CITATIONS (3)