ZFIN ID: ZDB-MRPHLNO-130327-9
Morpholino Name: MO1-col18a1a
Target: col18a1a (1)
Previous Name: MO1-col18a1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TAACAACCTACCTGGATAGAGCCTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-col18a1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-col18a1a No data available
PHENOTYPE
Phenotype resulting from MO1-col18a1a
No data available

Phenotype of all Fish created by or utilizing MO1-col18a1a
Phenotype Fish Conditions Figures
neural crest cell migration process quality, abnormal WT + MO1-col18a1a + MO2-col18a1a standard conditions Fig. 4 with image from Banerjee et al., 2013
OTHER MO1-col18a1a MORPHOLINO PAGESNo links to external sites
CITATIONS (2)