Morpholino

MO2-aggf1

ID
ZDB-MRPHLNO-130320-2
Name
MO2-aggf1
Previous Names
None
Target
Sequence
5' - CGCATCAATAGGGAGCAACCGCGAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-aggf1
Expressed Gene Anatomy Figures
dab2 Fig. 5 from Chen et al., 2013
etsrp Fig. 6 from Chen et al., 2013
flt4 Fig. 5 from Chen et al., 2013
gata1a Fig. 4 from Li et al., 2014
gata2a Fig. 5 from Li et al., 2014
hey2 Fig. 5 from Chen et al., 2013
lmo2 Fig. 5 from Li et al., 2014
myb Fig. 2 from Li et al., 2014
notch3 Fig. 5 from Chen et al., 2013
runx1 Fig. 2 from Li et al., 2014
spi1b Fig. 4 from Li et al., 2014
tal1 Fig. 5 from Li et al., 2014
Phenotype
Phenotype resulting from MO2-aggf1
Phenotype Fish Figures
caudal vein absent, abnormal y1Tg + MO2-aggf1 Fig. 4 with image from Kashiwada et al., 2015
caudal vein malformed, abnormal y1Tg + MO2-aggf1 Fig. 4 with image from Kashiwada et al., 2015
definitive hemopoiesis process quality, abnormal AB + MO2-aggf1 Fig. 2 from Li et al., 2014
dorsal longitudinal anastomotic vessel immature, abnormal AB + MO2-aggf1 Fig. 4 from Chen et al., 2013
dorsal longitudinal anastomotic vessel morphology, abnormal la116Tg + MO2-aggf1 Fig. 4 from Chen et al., 2013
intersegmental vessel morphology, abnormal la116Tg + MO2-aggf1 Fig. 4 from Chen et al., 2013
lymphangioblast cord cell decreased amount, abnormal AB + MO2-aggf1 Fig. 4 from Chen et al., 2013
mid cerebral vein immature, abnormal AB + MO2-aggf1 Fig. S8 from Chen et al., 2013
subintestinal vein absent, abnormal AB + MO2-aggf1 Fig. 4 from Chen et al., 2013
Phenotype of all Fish created by or utilizing MO2-aggf1
Phenotype Fish Conditions Figures
lymphangioblast cord cell decreased amount, abnormal AB + MO2-aggf1 standard conditions Fig. 4 from Chen et al., 2013
subintestinal vein absent, abnormal AB + MO2-aggf1 standard conditions Fig. 4 from Chen et al., 2013
definitive hemopoiesis process quality, abnormal AB + MO2-aggf1 control Fig. 2 from Li et al., 2014
mid cerebral vein immature, abnormal AB + MO2-aggf1 standard conditions Fig. S8 from Chen et al., 2013
dorsal longitudinal anastomotic vessel immature, abnormal AB + MO2-aggf1 standard conditions Fig. 4 from Chen et al., 2013
dorsal longitudinal anastomotic vessel morphology, abnormal la116Tg + MO2-aggf1 standard conditions Fig. 4 from Chen et al., 2013
intersegmental vessel morphology, abnormal la116Tg + MO2-aggf1 standard conditions Fig. 4 from Chen et al., 2013
caudal vein malformed, abnormal y1Tg + MO2-aggf1 standard conditions Fig. 4 with image from Kashiwada et al., 2015
caudal vein absent, abnormal y1Tg + MO2-aggf1 standard conditions Fig. 4 with image from Kashiwada et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.