header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-130320-2
Morpholino Name: MO2-aggf1
Target: aggf1 (1)
Sequence:
5' - CGCATCAATAGGGAGCAACCGCGAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-aggf1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-aggf1
Expressed Gene Anatomy Figures
dab2 Fig. 5 from Chen et al., 2013
etv2 Fig. 6 from Chen et al., 2013
flt4 Fig. 5 from Chen et al., 2013
gata1a Fig. 4 from Li et al., 2014
gata2a Fig. 5 from Li et al., 2014
hey2 Fig. 5 from Chen et al., 2013
lmo2 Fig. 5 from Li et al., 2014
myb Fig. 2 from Li et al., 2014
notch3 Fig. 5 from Chen et al., 2013
runx1 Fig. 2 from Li et al., 2014
spi1b Fig. 4 from Li et al., 2014
tal1 Fig. 5 from Li et al., 2014
PHENOTYPE
Phenotype resulting from MO2-aggf1
Phenotype of all Fish created by or utilizing MO2-aggf1
Genome Resources:
CITATIONS (3)