header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-130305-2
Morpholino Name: MO3-lamc1
Target: lamc1 (1)
Sequence:
5' - TGTGCCTTTTGCTATTGCGACCTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This morpholino is missing one nt (T).
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-lamc1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-lamc1 No data available
PHENOTYPE
Phenotype resulting from MO3-lamc1
Phenotype of all Fish created by or utilizing MO3-lamc1
Genome Resources:
CITATIONS (12)