ZFIN ID: ZDB-MRPHLNO-130227-1
Morpholino Name: MO1-alx1
Target: alx1 (1)
Previous Name: alx1i1e2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CACGCCTGAGGAGGTCACAGAAAAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-alx1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-alx1
Expressed Gene Anatomy Figures
alx3 Fig. 7 from Dee et al., 2013
foxd3 Fig. 5 from Dee et al., 2013
myod1 Fig. 5 from Dee et al., 2013
sox10 Fig. 5Fig. 7 from Dee et al., 2013
PHENOTYPE
Phenotype resulting from MO1-alx1
Phenotype Figures
ceratobranchial cartilage absent, abnormal Fig. 4 from Dee et al., 2013
cornea disorganized, abnormal Fig. 3 from Dee et al., 2013
cranial neural crest physical object quality, abnormal Fig. 5Fig. 6 from Dee et al., 2013
cranial neural crest cell mislocalised, abnormal Fig. 7 from Dee et al., 2013
embryonic camera-type eye morphogenesis decreased process quality, abnormal Fig. 3 from Dee et al., 2013
embryonic neurocranium morphogenesis decreased process quality, abnormal Fig. 4Fig. 7 from Dee et al., 2013
embryonic viscerocranium morphogenesis decreased process quality, abnormal Fig. 3Fig. 4 from Dee et al., 2013
ethmoid cartilage decreased size, abnormal Fig. 4 from Dee et al., 2013
eye decreased size, abnormal Fig. 3 from Dee et al., 2013
head decreased size, abnormal Fig. 3 from Dee et al., 2013
heart edematous, abnormal Fig. 3 from Dee et al., 2013
lens decreased size, abnormal Fig. 3 from Dee et al., 2013
mandibular arch skeleton absent, abnormal Fig. 3 from Dee et al., 2013
Meckel's cartilage absent, abnormal Fig. 4 from Dee et al., 2013
neural crest cell development decreased process quality, abnormal Fig. 5 from Dee et al., 2013
neural crest cell migration decreased process quality, abnormal Fig. 6Fig. 7 from Dee et al., 2013
neurocranial trabecula absent, abnormal Fig. 7 from Dee et al., 2013
neurocranial trabecula decreased size, abnormal Fig. 4 from Dee et al., 2013
palatoquadrate cartilage absent, abnormal Fig. 4 from Dee et al., 2013
retinal photoreceptor layer disorganized, abnormal Fig. 3 from Dee et al., 2013

Phenotype of all Fish created by or utilizing MO1-alx1
Phenotype Fish Conditions Figures
ethmoid cartilage decreased size, abnormal WT + MO1-alx1 standard conditions Fig. 4 from Dee et al., 2013
mandibular arch skeleton absent, abnormal WT + MO1-alx1 standard conditions Fig. 3 from Dee et al., 2013
embryonic neurocranium morphogenesis decreased process quality, abnormal WT + MO1-alx1 standard conditions Fig. 4Fig. 7 from Dee et al., 2013
neural crest cell migration decreased process quality, abnormal WT + MO1-alx1 standard conditions Fig. 7 from Dee et al., 2013
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO1-alx1 standard conditions Fig. 3Fig. 4 from Dee et al., 2013
neurocranial trabecula decreased size, abnormal WT + MO1-alx1 standard conditions Fig. 4 from Dee et al., 2013
head decreased size, abnormal WT + MO1-alx1 standard conditions Fig. 3 from Dee et al., 2013
neural crest cell development decreased process quality, abnormal WT + MO1-alx1 standard conditions Fig. 5 from Dee et al., 2013
palatoquadrate cartilage absent, abnormal WT + MO1-alx1 standard conditions Fig. 4 from Dee et al., 2013
retinal photoreceptor layer disorganized, abnormal WT + MO1-alx1 standard conditions Fig. 3 from Dee et al., 2013
Meckel's cartilage absent, abnormal WT + MO1-alx1 standard conditions Fig. 4 from Dee et al., 2013
cranial neural crest physical object quality, abnormal WT + MO1-alx1 standard conditions Fig. 5 from Dee et al., 2013
embryonic camera-type eye morphogenesis decreased process quality, abnormal WT + MO1-alx1 standard conditions Fig. 3 from Dee et al., 2013
ceratobranchial cartilage absent, abnormal WT + MO1-alx1 standard conditions Fig. 4 from Dee et al., 2013
heart edematous, abnormal WT + MO1-alx1 standard conditions Fig. 3 from Dee et al., 2013
eye decreased size, abnormal WT + MO1-alx1 standard conditions Fig. 3 from Dee et al., 2013
neurocranial trabecula absent, abnormal WT + MO1-alx1 standard conditions Fig. 7 from Dee et al., 2013
cranial neural crest cell mislocalised, abnormal WT + MO1-alx1 standard conditions Fig. 7 from Dee et al., 2013
cornea disorganized, abnormal WT + MO1-alx1 standard conditions Fig. 3 from Dee et al., 2013
lens decreased size, abnormal WT + MO1-alx1 standard conditions Fig. 3 from Dee et al., 2013
cranial neural crest physical object quality, abnormal ba2Tg + MO1-alx1 standard conditions Fig. 6 from Dee et al., 2013
neural crest cell migration decreased process quality, abnormal ba2Tg + MO1-alx1 standard conditions Fig. 6Fig. 7 from Dee et al., 2013
cranial neural crest cell mislocalised, abnormal ba2Tg + MO1-alx1 standard conditions Fig. 7 from Dee et al., 2013
Genome Resources:
CITATIONS (1)