ZFIN ID: ZDB-MRPHLNO-130226-4
Morpholino Name: MO1-asip1
Target: asip1 (1)
Previous Name: asp ATG MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGCACAGCCACAATGACGGACTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-asip1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-asip1
Expressed Gene Anatomy Figures
pmch whole organism Fig. 4 from Zhang et al., 2010
pmchl whole organism Fig. 4 from Zhang et al., 2010
PHENOTYPE 
Phenotype resulting from MO1-asip1
No data available

Phenotype of all Fish created by or utilizing MO1-asip1
No data available
OTHER MO1-asip1 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)