ZFIN ID: ZDB-MRPHLNO-121106-2
Morpholino Name: MO4-foxi1
Target: foxi1 (1)
Sequence:
5' - ACTCATGTTGACTACTCCTCCCACT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-foxi1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-foxi1 No data available
PHENOTYPE
Phenotype resulting from MO4-foxi1
No data available

Phenotype of all Fish created by or utilizing MO4-foxi1
No data available
OTHER MO4-foxi1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)