header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-121016-3
Morpholino Name: MO5-robo2
Target: robo2 (1)
Sequence:
5' - AAGGACCCATCCTGTCATAGTCCAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-robo2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-robo2
Expressed Gene Anatomy Figures
dcc Fig. 7 from Zhang et al., 2012
robo2 Fig. 7 from Zhang et al., 2012
PHENOTYPE
Phenotype resulting from MO5-robo2
Phenotype of all Fish created by or utilizing MO5-robo2
Phenotype Fish Conditions Figures
supraoptic tract misrouted, abnormal b1204Tg + MO5-robo2 standard conditions Fig. 5Fig. 6 from Zhang et al., 2012
dorso-rostral cluster neuron projection mislocalised, abnormal b1204Tg + MO5-robo2 standard conditions Fig. 5Fig. 6 from Zhang et al., 2012
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO5-robo2 standard conditions Fig. 5Fig. 6 from Zhang et al., 2012
dorso-rostral cluster neuron projection misrouted, abnormal b1204Tg + MO5-robo2 standard conditions Fig. 5Fig. 6 from Zhang et al., 2012
anterior commissure morphogenesis process quality, abnormal b1204Tg + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
supraoptic tract axon extension process quality, abnormal b1204Tg + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
cranial nerve VIII axon guidance process quality, abnormal zc7Tg + MO4-tp53 + MO5-robo2 control Fig. 8 from Zecca et al., 2015
cranial nerve VIII defasciculated, abnormal zc7Tg + MO4-tp53 + MO5-robo2 control Fig. 8 from Zecca et al., 2015
cranial nerve VIII axon mislocalised, abnormal zc7Tg + MO4-tp53 + MO5-robo2 control Fig. 8 from Zecca et al., 2015
anterior commissure morphogenesis process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection misrouted, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection mislocalised, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
supraoptic tract axon extension process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
OTHER MO5-robo2 MORPHOLINO PAGES No links to external sites
CITATIONS (2)