ZFIN ID: ZDB-MRPHLNO-121004-2
Morpholino Name: MO2-sf3b1
Target: sf3b1 (1)
Previous Name: sf3b1ATGmo (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGCGATCTGCGCCATTTTCGTGCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-sf3b1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-sf3b1 No data available
PHENOTYPE
Phenotype resulting from MO2-sf3b1
Phenotype Figures
embryo development arrested, abnormal Fig. 4 with image from An et al., 2012
hematopoietic progenitor cell differentiation disrupted, abnormal Fig. SE1 from De La Garza et al., 2016
melanocyte absent, abnormal Fig. 4 with image from An et al., 2012
myeloid cell differentiation disrupted, abnormal Fig. SE1 from De La Garza et al., 2016
nucleate erythrocyte decreased amount, abnormal Fig. SE1 from De La Garza et al., 2016
nucleate erythrocyte differentiation disrupted, abnormal Fig. SE1 from De La Garza et al., 2016

Phenotype of all Fish created by or utilizing MO2-sf3b1
Phenotype Fish Conditions Figures
melanocyte absent, abnormal sf3b1b460/b460 + MO2-sf3b1 standard conditions Fig. 4 with image from An et al., 2012
embryo development arrested, abnormal sf3b1b460/b460 + MO2-sf3b1 standard conditions Fig. 4 with image from An et al., 2012
melanocyte absent, abnormal AB + MO2-sf3b1 standard conditions Fig. 4 with image from An et al., 2012
nucleate erythrocyte differentiation disrupted, abnormal WT + MO2-sf3b1 standard conditions Fig. SE1 from De La Garza et al., 2016
hematopoietic progenitor cell differentiation disrupted, abnormal WT + MO2-sf3b1 standard conditions Fig. SE1 from De La Garza et al., 2016
myeloid cell differentiation disrupted, abnormal WT + MO2-sf3b1 standard conditions Fig. SE1 from De La Garza et al., 2016
nucleate erythrocyte decreased amount, abnormal WT + MO2-sf3b1 standard conditions Fig. SE1 from De La Garza et al., 2016
OTHER MO2-sf3b1 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)