Morpholino

MO1-smyd2a

ID

ZDB-MRPHLNO-120824-1

Name

MO1-smyd2a

Previous Names

5 prime UTR MO (1)

Target

smyd2a (1)

Sequence

5' - ATCGCTATTGACCTGCTGCTCGCGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-smyd2a

No data available

Phenotype

Phenotype resulting from MO1-smyd2a

Phenotype	Fish	Figures
atrium malformed, abnormal	WT + MO1-smyd2a	Fig. 5, text only from Voelkel et al., 2013
cardiac ventricle malformed, abnormal	WT + MO1-smyd2a	Fig. 5, text only from Voelkel et al., 2013
heart decreased contractility, abnormal	WT + MO1-smyd2a	Fig. 5 from Voelkel et al., 2013
heart decreased functionality, abnormal	WT + MO1-smyd2a	Fig. 5 from Voelkel et al., 2013
heart decreased thickness, abnormal	WT + MO1-smyd2a	text only from Voelkel et al., 2013
heart elongated, abnormal	WT + MO1-smyd2a	text only from Voelkel et al., 2013 Fig. 5 from Donlin et al., 2012
heart contraction decreased rate, abnormal	WT + MO1-smyd2a	text only from Voelkel et al., 2013 text only from Donlin et al., 2012
heart development disrupted, abnormal	WT + MO1-smyd2a	Fig. 5 from Donlin et al., 2012
pericardium edematous, abnormal	WT + MO1-smyd2a	text only from Voelkel et al., 2013 Fig. 5 from Donlin et al., 2012
post-vent region increased curvature, abnormal	WT + MO1-smyd2a	Fig. 5 from Donlin et al., 2012
sarcomere organization disrupted, abnormal	WT + MO1-smyd2a	Fig. 5 from Donlin et al., 2012
sinus venosus edematous, abnormal	WT + MO1-smyd2a	text only from Voelkel et al., 2013 Fig. 5 from Donlin et al., 2012
skeletal muscle morphology, abnormal	WT + MO1-smyd2a	text only from Voelkel et al., 2013
skeletal muscle cell disorganized, abnormal	WT + MO1-smyd2a	Fig. 5 from Donlin et al., 2012
skeletal muscle cell I band disorganized, abnormal	WT + MO1-smyd2a	Fig. 5 from Donlin et al., 2012
skeletal muscle cell sarcomere disorganized, abnormal	WT + MO1-smyd2a	Fig. 5 from Donlin et al., 2012
skeletal muscle cell Z disc disorganized, abnormal	WT + MO1-smyd2a	Fig. 5 from Donlin et al., 2012
skeletal muscle tissue development disrupted, abnormal	WT + MO1-smyd2a	Fig. 5 from Donlin et al., 2012
whole organism decreased mobility, abnormal	WT + MO1-smyd2a	text only from Donlin et al., 2012

Phenotype of all Fish created by or utilizing MO1-smyd2a

Phenotype	Fish	Conditions	Figures
heart decreased thickness, abnormal	WT + MO1-smyd2a	standard conditions	text only from Voelkel et al., 2013
skeletal muscle cell Z disc disorganized, abnormal	WT + MO1-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
heart decreased functionality, abnormal	WT + MO1-smyd2a	standard conditions	Fig. 5 from Voelkel et al., 2013
sarcomere organization disrupted, abnormal	WT + MO1-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
cardiac ventricle malformed, abnormal	WT + MO1-smyd2a	standard conditions	Fig. 5, text only from Voelkel et al., 2013
heart development disrupted, abnormal	WT + MO1-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
post-vent region increased curvature, abnormal	WT + MO1-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
skeletal muscle tissue development disrupted, abnormal	WT + MO1-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
skeletal muscle cell I band disorganized, abnormal	WT + MO1-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
heart contraction decreased rate, abnormal	WT + MO1-smyd2a	standard conditions	text only from Voelkel et al., 2013 text only from Donlin et al., 2012
skeletal muscle morphology, abnormal	WT + MO1-smyd2a	standard conditions	text only from Voelkel et al., 2013
heart elongated, abnormal	WT + MO1-smyd2a	standard conditions	text only from Voelkel et al., 2013 Fig. 5 from Donlin et al., 2012
atrium malformed, abnormal	WT + MO1-smyd2a	standard conditions	Fig. 5, text only from Voelkel et al., 2013
pericardium edematous, abnormal	WT + MO1-smyd2a	standard conditions	text only from Voelkel et al., 2013 Fig. 5 from Donlin et al., 2012
whole organism decreased mobility, abnormal	WT + MO1-smyd2a	standard conditions	text only from Donlin et al., 2012
skeletal muscle cell sarcomere disorganized, abnormal	WT + MO1-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
heart decreased contractility, abnormal	WT + MO1-smyd2a	standard conditions	Fig. 5 from Voelkel et al., 2013
sinus venosus edematous, abnormal	WT + MO1-smyd2a	standard conditions	text only from Voelkel et al., 2013 Fig. 5 from Donlin et al., 2012
skeletal muscle cell disorganized, abnormal	WT + MO1-smyd2a	standard conditions	Fig. 5 from Donlin et al., 2012
heart decreased contractility, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	Fig. 5 from Voelkel et al., 2013
post-vent region increased curvature, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	Fig. 5 from Donlin et al., 2012
whole organism decreased mobility, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	text only from Donlin et al., 2012
heart contraction decreased rate, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	text only from Donlin et al., 2012
sinus venosus edematous, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	Fig. 5 from Donlin et al., 2012
cardiac ventricle malformed, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	Fig. 5 from Voelkel et al., 2013
atrium malformed, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	Fig. 5 from Voelkel et al., 2013
peptidyl-lysine methylation decreased occurrence, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	Fig. 5 from Donlin et al., 2012
pericardium edematous, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	Fig. 5 from Donlin et al., 2012
heart decreased functionality, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	Fig. 5 from Voelkel et al., 2013
skeletal muscle morphology, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	text only from Voelkel et al., 2013
heart elongated, abnormal	WT + MO1-smyd2a + MO1-smyd2b	standard conditions	Fig. 5 from Donlin et al., 2012

Citations