ZFIN ID: ZDB-MRPHLNO-120419-3
Morpholino Name: MO2-ptprfa
Target: ptprfa (1)
Sequence:
5' - ATGATTTGAAGATGGCACTCACCGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-ptprfa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-ptprfa No data available
PHENOTYPE
Phenotype resulting from MO2-ptprfa
No data available

Phenotype of all Fish created by or utilizing MO2-ptprfa
Genome Resources:
CITATIONS (1)