ZFIN ID: ZDB-MRPHLNO-120419-2
Morpholino Name: MO1-ptprfb
Target: ptprfb
Sequence:
5' - GTGACAAAACTCTTACCTTAAAAGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ptprfb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ptprfb No data available
PHENOTYPE
Phenotype resulting from MO1-ptprfb
No data available

Phenotype of all Fish created by or utilizing MO1-ptprfb
Genome Resources:
CITATIONS (2)