ZFIN ID: ZDB-MRPHLNO-120409-2
Morpholino Name: MO3-ocrl
Target: ocrl (1)
Sequence:
5' - AGCCTCCAAATAAAGGATACGGCTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-ocrl No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-ocrl
Expressed Gene Anatomy Figures
myca Fig. 4 from Coon et al., 2012
PHENOTYPE
Phenotype resulting from MO3-ocrl
Phenotype Figures
cartilage development disrupted, abnormal Fig. 4 from Coon et al., 2012
ceratohyal cartilage malformed, abnormal Fig. 4 from Coon et al., 2012
cranial vault anterior region flattened, abnormal Fig. 3 from Coon et al., 2012
ethmoid cartilage absent, abnormal Fig. 4 from Coon et al., 2012
eye decreased size, abnormal Fig. 3 from Coon et al., 2012
head decreased size, abnormal Fig. 3 from Coon et al., 2012
heart looping disrupted, abnormal Fig. 4 from Coon et al., 2012
heart tube displaced to whole organism central region, abnormal Fig. 4 from Coon et al., 2012
heart tube displaced to whole organism right side, abnormal Fig. 4 from Coon et al., 2012
Meckel's cartilage decreased length, abnormal Fig. 4 from Coon et al., 2012
melanocyte decreased amount, abnormal Fig. 3 from Coon et al., 2012
melanocyte mislocalised, abnormal Fig. 3 from Coon et al., 2012
neural crest cell migration disrupted, abnormal Fig. S1 from Coon et al., 2012
neurocranium decreased length, abnormal Fig. 4 from Coon et al., 2012
palatoquadrate cartilage decreased length, abnormal Fig. 4 from Coon et al., 2012
pericardium edematous, abnormal Fig. 3 from Coon et al., 2012
pharyngeal arch 3-7 lacks parts or has fewer parts of type cartilage tissue, abnormal Fig. 4 from Coon et al., 2012
pronephric duct motile cilium decreased length, abnormal Fig. 4 from Coon et al., 2012
pronephros anterior region cystic, abnormal Fig. 3 from Coon et al., 2012
whole organism curled, abnormal Fig. 3 from Coon et al., 2012
whole organism semi-viable, abnormal Fig. 3 from Coon et al., 2012
whole organism anterior-posterior axis decreased length, abnormal Fig. 3 from Coon et al., 2012

Phenotype of all Fish created by or utilizing MO3-ocrl
Phenotype Fish Conditions Figures
eye decreased size, abnormal AB/TL + MO3-ocrl standard conditions Fig. 3 from Coon et al., 2012
heart tube displaced to whole organism right side, abnormal AB/TL + MO3-ocrl standard conditions Fig. 4 from Coon et al., 2012
whole organism semi-viable, abnormal AB/TL + MO3-ocrl standard conditions Fig. 3 from Coon et al., 2012
pericardium edematous, abnormal AB/TL + MO3-ocrl standard conditions Fig. 3 from Coon et al., 2012
pharyngeal arch 3-7 lacks parts or has fewer parts of type cartilage tissue, abnormal AB/TL + MO3-ocrl standard conditions Fig. 4 from Coon et al., 2012
heart looping disrupted, abnormal AB/TL + MO3-ocrl standard conditions Fig. 4 from Coon et al., 2012
melanocyte decreased amount, abnormal AB/TL + MO3-ocrl standard conditions Fig. 3 from Coon et al., 2012
palatoquadrate cartilage decreased length, abnormal AB/TL + MO3-ocrl standard conditions Fig. 4 from Coon et al., 2012
neurocranium decreased length, abnormal AB/TL + MO3-ocrl standard conditions Fig. 4 from Coon et al., 2012
whole organism anterior-posterior axis decreased length, abnormal AB/TL + MO3-ocrl standard conditions Fig. 3 from Coon et al., 2012
heart tube displaced to whole organism central region, abnormal AB/TL + MO3-ocrl standard conditions Fig. 4 from Coon et al., 2012
pronephros anterior region cystic, abnormal AB/TL + MO3-ocrl standard conditions Fig. 3 from Coon et al., 2012
head decreased size, abnormal AB/TL + MO3-ocrl standard conditions Fig. 3 from Coon et al., 2012
pronephric duct motile cilium decreased length, abnormal AB/TL + MO3-ocrl standard conditions Fig. 4 from Coon et al., 2012
melanocyte mislocalised, abnormal AB/TL + MO3-ocrl standard conditions Fig. 3 from Coon et al., 2012
cartilage development disrupted, abnormal AB/TL + MO3-ocrl standard conditions Fig. 4 from Coon et al., 2012
ethmoid cartilage absent, abnormal AB/TL + MO3-ocrl standard conditions Fig. 4 from Coon et al., 2012
cranial vault anterior region flattened, abnormal AB/TL + MO3-ocrl standard conditions Fig. 3 from Coon et al., 2012
whole organism curled, abnormal AB/TL + MO3-ocrl standard conditions Fig. 3 from Coon et al., 2012
Meckel's cartilage decreased length, abnormal AB/TL + MO3-ocrl standard conditions Fig. 4 from Coon et al., 2012
ceratohyal cartilage malformed, abnormal AB/TL + MO3-ocrl standard conditions Fig. 4 from Coon et al., 2012
neural crest cell migration disrupted, abnormal ba2Tg + MO3-ocrl standard conditions Fig. S1 from Coon et al., 2012
Genome Resources:
CITATIONS (1)