ZFIN ID: ZDB-MRPHLNO-120405-1
Morpholino Name: MO1-ocrl
Target: ocrl (1)
Previous Name: ATGMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AATCCCAAATGAAGGTTCCATCATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ocrl No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ocrl
Expressed Gene Anatomy Figures
egr2b Fig. S7 from Ramirez et al., 2012
hoxb1a Fig. S7 from Ramirez et al., 2012
ocrl Fig. 3 from Ramirez et al., 2012
pax2a Fig. S7 from Ramirez et al., 2012
PHENOTYPE
Phenotype resulting from MO1-ocrl
Phenotype of all Fish created by or utilizing MO1-ocrl
Genome Resources:
CITATIONS (2)