Morpholino

MO2-wnt16

ID

ZDB-MRPHLNO-120329-2

Name

MO2-wnt16

Previous Names

W16MO2 (1)

Target

wnt16 (1)

Sequence

5' - GCGTGGAATACTTACATCCAACTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-wnt16

Expressed Gene	Anatomy	Figures
etv4	segmental plate somite	Fig. 4 from Lee et al., 2014
fgfr4	somite	Fig. 4 from Lee et al., 2014
gata2b	ventral wall of dorsal aorta	Fig. 6 from Butko et al., 2015
rspo1	trunk mesoderm	Fig. S2 from Genthe et al., 2017
runx1	(not) dorsal aorta hematopoietic stem cell hematopoietic multipotent progenitor cell ventral wall of dorsal aorta	Fig. S2 from Genthe et al., 2017 Fig. 6 from Butko et al., 2015 Fig. 7 from Kim et al., 2014 Fig. 4 from Lee et al., 2014
wnt16	somite	Fig. S2 from Genthe et al., 2017

Phenotype

Phenotype resulting from MO2-wnt16

Phenotype	Fish	Figures
dorsal aorta hematopoietic stem cell runx1 expression absent, abnormal	WT + MO2-wnt16	Fig. S2 from Genthe et al., 2017
dorsal aorta hematopoietic stem cell absent, abnormal	WT + MO2-wnt16	Fig. S2 from Genthe et al., 2017
hematopoietic progenitor cell differentiation process quality, abnormal	AB + MO2-wnt16	Fig. 7 from Kim et al., 2014
somite fgfr4 expression decreased amount, abnormal	AB + MO2-wnt16	Fig. 4 from Lee et al., 2014
somite etv4 expression decreased amount, abnormal	AB + MO2-wnt16	Fig. 4 from Lee et al., 2014
somite wnt16 expression decreased amount, abnormal	WT + MO2-wnt16	Fig. S2 from Genthe et al., 2017
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	AB + MO2-wnt16	Fig. 4 from Lee et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal	AB + MO2-wnt16	Fig. 4 from Lee et al., 2014

Phenotype of all Fish created by or utilizing MO2-wnt16

Phenotype	Fish	Conditions	Figures
somite etv4 expression decreased amount, abnormal	AB + MO2-wnt16	standard conditions	Fig. 4 from Lee et al., 2014
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	AB + MO2-wnt16	standard conditions	Fig. 4 from Lee et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal	AB + MO2-wnt16	standard conditions	Fig. 7 from Kim et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal	AB + MO2-wnt16	standard conditions	Fig. 4 from Lee et al., 2014
somite fgfr4 expression decreased amount, abnormal	AB + MO2-wnt16	standard conditions	Fig. 4 from Lee et al., 2014
hematopoietic stem cell differentiation disrupted, abnormal	WT + MO1-wnt16 + MO2-wnt16	standard conditions	Fig. 1, Fig. 3 from Clements et al., 2011
trunk altered number of intersegmental vessel, abnormal	WT + MO1-wnt16 + MO2-wnt16	standard conditions	Fig. 2 from Clements et al., 2011
intersegmental vessel spatial pattern, abnormal	WT + MO1-wnt16 + MO2-wnt16	standard conditions	Fig. 2 from Clements et al., 2011
Notch signaling pathway disrupted, abnormal	WT + MO1-wnt16 + MO2-wnt16	standard conditions	Fig. 3 from Clements et al., 2011
hematopoietic stem cell absent, abnormal	WT + MO1-wnt16 + MO2-wnt16	standard conditions	Fig. 1 from Clements et al., 2011
thymus T cell absent, abnormal	WT + MO1-wnt16 + MO2-wnt16	standard conditions	Fig. 1 from Clements et al., 2011
dorsal aorta hematopoietic stem cell runx1 expression absent, abnormal	WT + MO2-wnt16	standard conditions	Fig. S2 from Genthe et al., 2017
somite wnt16 expression decreased amount, abnormal	WT + MO2-wnt16	standard conditions	Fig. S2 from Genthe et al., 2017
dorsal aorta hematopoietic stem cell absent, abnormal	WT + MO2-wnt16	standard conditions	Fig. S2 from Genthe et al., 2017
ventral wall of dorsal aorta runx1 expression amount, ameliorated	pd3Tg + MO2-wnt16	heat shock	Fig. 4 from Lee et al., 2014
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal	pd3Tg + MO2-wnt16	heat shock	Fig. 4 from Lee et al., 2014

Citations