Morpholino

MO1-popdc2

ID
ZDB-MRPHLNO-120322-2
Name
MO1-popdc2
Previous Names
None
Target
Sequence
5' - CTAATCCTGTGAAAGCAGAAGATCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO. The author provided this corrected sequence.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-popdc2
No data available
Phenotype
Phenotype resulting from MO1-popdc2
Phenotype Fish Figures
cardiac conduction disrupted, abnormal s878Tg + MO1-popdc2 Fig. 8 with image,  Fig. 9 with image from Kirchmaier et al., 2012
fin musculature disorganized, abnormal WT + MO1-popdc2 Fig. 5 with image from Kirchmaier et al., 2012
heart electrical conductivity, abnormal s878Tg + MO1-popdc2 Fig. 9 with image from Kirchmaier et al., 2012
heart contraction arrhythmic, abnormal WT + MO1-popdc2 Fig. 8 with image from Kirchmaier et al., 2012
heart contraction decreased frequency, abnormal WT + MO1-popdc2 Fig. 8 with image from Kirchmaier et al., 2012
myotome irregular spatial pattern, abnormal WT + MO1-popdc2 Fig. 2 with image from Kirchmaier et al., 2012
myotome U-shaped, abnormal WT + MO1-popdc2 Fig. 2 with image,  Fig. 4 with image from Kirchmaier et al., 2012
myotome muscle tendon junction decreased thickness, abnormal WT + MO1-popdc2 Fig. 4 with image from Kirchmaier et al., 2012
myotome muscle tendon junction irregular spatial pattern, abnormal WT + MO1-popdc2 Fig. 4 with image from Kirchmaier et al., 2012
myotome muscle tendon junction structure, abnormal WT + MO1-popdc2 Fig. 4 with image from Kirchmaier et al., 2012
myotome myofibril decreased amount, abnormal WT + MO1-popdc2 Fig. 2 with image from Kirchmaier et al., 2012
myotome myofibril distributed, abnormal WT + MO1-popdc2 Fig. 2 with image from Kirchmaier et al., 2012
pericardium edematous, abnormal WT + MO1-popdc2 Fig. 5 with image from Kirchmaier et al., 2012
skeletal muscle cell disorganized, abnormal WT + MO1-popdc2 Fig. 2 with image from Kirchmaier et al., 2012
skeletal muscle fiber development disrupted, abnormal WT + MO1-popdc2 text only from Kirchmaier et al., 2012
trunk musculature disorganized, abnormal WT + MO1-popdc2 Fig. 5 with image,  text only from Kirchmaier et al., 2012
whole organism balance, abnormal WT + MO1-popdc2 text only from Kirchmaier et al., 2012
whole organism circling, abnormal WT + MO1-popdc2 text only from Kirchmaier et al., 2012
whole organism uncoordinated, abnormal WT + MO1-popdc2 text only from Kirchmaier et al., 2012
Phenotype of all Fish created by or utilizing MO1-popdc2
Phenotype Fish Conditions Figures
heart contraction arrhythmic, abnormal WT + MO1-popdc2 standard conditions Fig. 8 with image from Kirchmaier et al., 2012
whole organism circling, abnormal WT + MO1-popdc2 standard conditions text only from Kirchmaier et al., 2012
skeletal muscle cell disorganized, abnormal WT + MO1-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
fin musculature disorganized, abnormal WT + MO1-popdc2 standard conditions Fig. 5 with image from Kirchmaier et al., 2012
whole organism uncoordinated, abnormal WT + MO1-popdc2 standard conditions text only from Kirchmaier et al., 2012
heart contraction decreased frequency, abnormal WT + MO1-popdc2 standard conditions Fig. 8 with image from Kirchmaier et al., 2012
myotome muscle tendon junction structure, abnormal WT + MO1-popdc2 standard conditions Fig. 4 with image from Kirchmaier et al., 2012
cardiac conduction disrupted, abnormal WT + MO1-popdc2 standard conditions Fig. 8 with image from Kirchmaier et al., 2012
whole organism balance, abnormal WT + MO1-popdc2 standard conditions text only from Kirchmaier et al., 2012
skeletal muscle fiber development disrupted, abnormal WT + MO1-popdc2 standard conditions text only from Kirchmaier et al., 2012
trunk musculature disorganized, abnormal WT + MO1-popdc2 standard conditions Fig. 5 with image,  text only from Kirchmaier et al., 2012
myotome muscle tendon junction irregular spatial pattern, abnormal WT + MO1-popdc2 standard conditions Fig. 4 with image from Kirchmaier et al., 2012
myotome U-shaped, abnormal WT + MO1-popdc2 standard conditions Fig. 2 with image,  Fig. 4 with image from Kirchmaier et al., 2012
myotome muscle tendon junction decreased thickness, abnormal WT + MO1-popdc2 standard conditions Fig. 4 with image from Kirchmaier et al., 2012
pericardium edematous, abnormal WT + MO1-popdc2 standard conditions Fig. 5 with image from Kirchmaier et al., 2012
myotome myofibril distributed, abnormal WT + MO1-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
myotome myofibril decreased amount, abnormal WT + MO1-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
myotome irregular spatial pattern, abnormal WT + MO1-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
atrium orientation cardiac ventricle, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 7 with image from Kirchmaier et al., 2012
skeletal muscle cell disorganized, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
cardiac muscle cell myofibril decreased amount, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 7 with image from Kirchmaier et al., 2012
heart looping process quality, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 7 with image from Kirchmaier et al., 2012
skeletal muscle cell decreased mass, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
myotome U-shaped, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
slow muscle cell disorganized, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
fast muscle cell disorganized, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
slow muscle cell misaligned with slow muscle cell, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
fast muscle cell variant shape, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
slow muscle cell undulate, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
myotome myofibril distributed, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
heart malformed, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 7 with image from Kirchmaier et al., 2012
myotome myofibril decreased amount, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
myotome irregular spatial pattern, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
heart electrical conductivity, abnormal s878Tg + MO1-popdc2 standard conditions Fig. 9 with image from Kirchmaier et al., 2012
cardiac conduction disrupted, abnormal s878Tg + MO1-popdc2 standard conditions Fig. 9 with image from Kirchmaier et al., 2012
cephalic musculature hypoplastic, abnormal zf13Tg + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 6 with image from Kirchmaier et al., 2012
cephalic musculature malformed, abnormal zf13Tg + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 6 with image from Kirchmaier et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.