header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120320-3
Morpholino Name: MO1-ctsk
Target: ctsk (1)
Previous Name: SB MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTAACAATACTTACCATGTCACCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ctsk No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ctsk No data available
PHENOTYPE
Phenotype resulting from MO1-ctsk
No data available

Phenotype of all Fish created by or utilizing MO1-ctsk
Phenotype Fish Conditions Figures
cranial cartilage sox9a expression amount, ameliorated WT + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
dermatocranium col10a1a expression amount, ameliorated WT + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
cranial cartilage col2a1a expression amount, ameliorated WT + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte mCherry expression amount, ameliorated hu5910Tg + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
ceratohyal cartilage chondrocyte mCherry expression amount, ameliorated hu5910Tg + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
palatoquadrate cartilage chondrocyte EGFP expression amount, ameliorated mw29Tg + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte EGFP expression amount, ameliorated mw29Tg + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte ab3-smad2 labeling amount, ameliorated y1Tg + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte ab1-smad labeling amount, ameliorated y1Tg + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
palatoquadrate cartilage chondrocyte ab1-smad labeling amount, ameliorated y1Tg + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
ceratohyal cartilage chondrocyte ab3-smad2 labeling amount, ameliorated y1Tg + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
OTHER MO1-ctsk MORPHOLINO PAGES No links to external sites
CITATIONS (3)