header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120319-8
Morpholino Name: MO1-dbt
Target: dbt (1)
Sequence:
5' - CGCACAGTAATGACCGCCGCCATCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-dbt No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-dbt No data available
PHENOTYPE
Phenotype resulting from MO1-dbt
Phenotype of all Fish created by or utilizing MO1-dbt
Genome Resources:
CITATIONS (1)