ZFIN ID: ZDB-MRPHLNO-120314-2
Morpholino Name: MO1-ahi1
Target: ahi1 (1)
Previous Name: SPL8MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCACACTCTGAAAGGGAAAAACATT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ahi1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ahi1
Expressed Gene Anatomy Figures
ahi1 whole organism Fig. 3 from Simms et al., 2012
PHENOTYPE 
Phenotype resulting from MO1-ahi1
Phenotype Figures
brain hydrocephalic, abnormal Fig. 3 from Elsayed et al., 2015
brain hydrocephalic, abnormal Fig. 3 from Simms et al., 2012
camera-type eye morphogenesis decreased process quality, abnormal Fig. 3 from Simms et al., 2012
eye malformed, abnormal Fig. 3 from Simms et al., 2012
heart bilateral symmetry, abnormal Fig. 5 from Simms et al., 2012
heart edematous, abnormal Fig. 3 from Simms et al., 2012
heart looping decreased process quality, abnormal Fig. 5 from Simms et al., 2012
inner ear has fewer parts of type otolith, abnormal Fig. 3 from Simms et al., 2012
inner ear morphogenesis decreased process quality, abnormal Fig. 3 from Simms et al., 2012
kidney morphogenesis decreased process quality, abnormal Fig. 6 from Simms et al., 2012
Kupffer's vesicle lacks all parts of type ciliated epithelial cell cilium, abnormal Fig. 4 from Simms et al., 2012
otic vesicle morphology, abnormal Fig. 3 from Elsayed et al., 2015
post-vent region curled, abnormal Fig. 3 from Simms et al., 2012
pronephric duct lacks parts or has fewer parts of type ciliated epithelial cell cilium, abnormal Fig. 6 from Simms et al., 2012
pronephros cystic, abnormal Fig. 3 from Simms et al., 2012
pronephros dilated, abnormal Fig. 3 from Simms et al., 2012
whole organism anatomical axis curved, abnormal Fig. 3 from Elsayed et al., 2015

Phenotype of all Fish created by or utilizing MO1-ahi1
Phenotype Fish Conditions Figures
whole organism anatomical axis curved, abnormal AB/TU + MO1-ahi1 standard conditions Fig. 3 from Elsayed et al., 2015
brain hydrocephalic, abnormal AB/TU + MO1-ahi1 standard conditions Fig. 3 from Elsayed et al., 2015
otic vesicle morphology, abnormal AB/TU + MO1-ahi1 standard conditions Fig. 3 from Elsayed et al., 2015
camera-type eye morphogenesis decreased process quality, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
eye malformed, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
heart edematous, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
pronephros cystic, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
pronephros dilated, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
inner ear has fewer parts of type otolith, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
post-vent region curled, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
brain hydrocephalic, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
inner ear morphogenesis decreased process quality, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
heart bilateral symmetry, abnormal twu34Tg + MO1-ahi1 standard conditions Fig. 5 from Simms et al., 2012
heart looping decreased process quality, abnormal twu34Tg + MO1-ahi1 standard conditions Fig. 5 from Simms et al., 2012
pronephric duct lacks parts or has fewer parts of type ciliated epithelial cell cilium, abnormal zf106Tg + MO1-ahi1 standard conditions Fig. 6 from Simms et al., 2012
Kupffer's vesicle lacks all parts of type ciliated epithelial cell cilium, abnormal zf106Tg + MO1-ahi1 standard conditions Fig. 4 from Simms et al., 2012
kidney morphogenesis decreased process quality, abnormal zf106Tg + MO1-ahi1 standard conditions Fig. 6 from Simms et al., 2012
motile cilium assembly decreased process quality, abnormal slc24a5b1/b1 + MO1-ahi1 standard conditions Fig. 4 from Simms et al., 2012
Kupffer's vesicle lacks all parts of type ciliated epithelial cell cilium, abnormal slc24a5b1/b1 + MO1-ahi1 standard conditions Fig. 4 from Simms et al., 2012
OTHER MO1-ahi1 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)