ZFIN ID: ZDB-MRPHLNO-120208-2
Morpholino Name: MO1-gfer
Target: gfer (1)
Sequence:
5' - CGTGTGCAGCTGCCATGTTGTTATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking (ATG)MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-gfer No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-gfer
Expressed Gene Anatomy Figures
cp Fig. 3 with image from Li et al., 2012
foxa3 Fig. 3 with image from Li et al., 2012
ins Fig. 3 with image from Li et al., 2012
prox1a Fig. 3 with image from Li et al., 2012
PHENOTYPE
Phenotype resulting from MO1-gfer
Phenotype of all Fish created by or utilizing MO1-gfer
Genome Resources:
CITATIONS (1)