ZFIN ID: ZDB-MRPHLNO-120207-8
Morpholino Name: MO2-tpbga
Target: tpbga (1)
Previous Names: MO2-tpbgl (1), waif1a MO2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AAATGCCCTCATTAGGCTGGCGTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO. Targets the 5'UTR.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-tpbga No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-tpbga
Expressed Gene Anatomy Figures
hoxb1b Fig. 3 with image from Kagermeier-Schenk et al., 2011
otx2b Fig. 3 with image from Kagermeier-Schenk et al., 2011
PHENOTYPE
Phenotype resulting from MO2-tpbga
Phenotype of all Fish created by or utilizing MO2-tpbga
Genome Resources:
CITATIONS (3)