ZFIN ID: ZDB-MRPHLNO-120207-7
Morpholino Name: MO1-tpbga
Target: tpbga (1)
Previous Names: MO1-tpbgl (1), waif1a MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAGATCCAAAGTGTCTCTCCAAGAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO. Targets the 5'UTR.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tpbga No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tpbga
Expressed Gene Anatomy Figures
cdx4 Fig. 2 with image from Kagermeier-Schenk et al., 2011
egr2b Fig. 8 with image from Kagermeier-Schenk et al., 2011
foxg1a Fig. 3 with image from Kagermeier-Schenk et al., 2011
gsc Fig. 3 with image from Kagermeier-Schenk et al., 2011
hoxb1b Fig. 3 with image from Kagermeier-Schenk et al., 2011
myod1 Fig. 8 with image from Kagermeier-Schenk et al., 2011
otx2b Fig. 3 with image from Kagermeier-Schenk et al., 2011
pax2a Fig. 8 with image from Kagermeier-Schenk et al., 2011
sp5l Fig. 2 with image from Kagermeier-Schenk et al., 2011
vent Fig. 2 with image from Kagermeier-Schenk et al., 2011
PHENOTYPE
Phenotype resulting from MO1-tpbga
Phenotype of all Fish created by or utilizing MO1-tpbga
Phenotype Fish Conditions Figures
anterior neural plate otx2b expression decreased distribution, abnormal WT + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
anatomical structure sp5l expression increased amount, abnormal WT + MO1-tpbga standard conditions Fig. 2 with image from Kagermeier-Schenk et al., 2011
presumptive telencephalon foxg1a expression decreased distribution, abnormal WT + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
posterior neural plate hoxb1b expression increased distribution, abnormal WT + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
whole organism dorsal region gsc expression decreased distribution, abnormal WT + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
anatomical structure cdx4 expression increased amount, abnormal WT + MO1-tpbga standard conditions Fig. 2 with image from Kagermeier-Schenk et al., 2011
anatomical structure vent expression increased amount, abnormal WT + MO1-tpbga standard conditions Fig. 2 with image from Kagermeier-Schenk et al., 2011
notochord aplastic/hypoplastic, abnormal WT + MO1-tcf7l1a + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
whole organism wholly dorsalized, abnormal WT + MO1-tcf7l1a + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye absent, abnormal WT + MO1-tcf7l1a + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye aplastic, abnormal WT + MO1-tcf7l1a + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
midbrain hindbrain boundary aplastic, abnormal WT + MO1-tcf7l1a + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye decreased size, abnormal WT + MO1-tcf7l1a + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
head anterior region truncated, abnormal WT + MO1-tcf7l1a + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
midbrain decreased size, abnormal WT + MO1-tcf7l1a + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
forebrain decreased size, abnormal WT + MO1-tcf7l1a + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
somite increased width, abnormal WT + MO1-tpbga + MO2-dkk1b standard conditions Fig. 8 with image from Kagermeier-Schenk et al., 2011
convergent extension involved in axis elongation process quality, abnormal WT + MO1-tpbga + MO2-dkk1b standard conditions Fig. 8 with image from Kagermeier-Schenk et al., 2011
midbrain hindbrain boundary increased width, abnormal WT + MO1-tpbga + MO2-dkk1b standard conditions Fig. 8 with image from Kagermeier-Schenk et al., 2011
somite condensed, abnormal WT + MO1-tpbga + MO2-dkk1b standard conditions Fig. 8 with image from Kagermeier-Schenk et al., 2011
rhombomere increased width, abnormal WT + MO1-tpbga + MO2-dkk1b standard conditions Fig. 8 with image from Kagermeier-Schenk et al., 2011
convergent extension disrupted, abnormal WT + MO1-tpbga + MO2-dkk1b standard conditions Fig. 8 with image from Kagermeier-Schenk et al., 2011
Genome Resources:
CITATIONS (3)